ID: 983892044 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:173039718-173039740 |
| Sequence | ACTATGTAGGGCCTACAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 37 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 1, 4: 34} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983892044_983892050 | 12 | Left | 983892044 | 4:173039718-173039740 | CCTGCTTGTAGGCCCTACATAGT | 0: 1 1: 0 2: 1 3: 1 4: 34 |
||
| Right | 983892050 | 4:173039753-173039775 | TACAAATTCACATTCCACATGGG | 0: 1 1: 0 2: 2 3: 21 4: 300 |
||||
| 983892044_983892049 | 11 | Left | 983892044 | 4:173039718-173039740 | CCTGCTTGTAGGCCCTACATAGT | 0: 1 1: 0 2: 1 3: 1 4: 34 |
||
| Right | 983892049 | 4:173039752-173039774 | CTACAAATTCACATTCCACATGG | 0: 1 1: 1 2: 2 3: 30 4: 272 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983892044 | Original CRISPR | ACTATGTAGGGCCTACAAGC AGG (reversed) | Intronic | ||