ID: 983892044

View in Genome Browser
Species Human (GRCh38)
Location 4:173039718-173039740
Sequence ACTATGTAGGGCCTACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 34}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983892044_983892050 12 Left 983892044 4:173039718-173039740 CCTGCTTGTAGGCCCTACATAGT 0: 1
1: 0
2: 1
3: 1
4: 34
Right 983892050 4:173039753-173039775 TACAAATTCACATTCCACATGGG 0: 1
1: 0
2: 2
3: 21
4: 300
983892044_983892049 11 Left 983892044 4:173039718-173039740 CCTGCTTGTAGGCCCTACATAGT 0: 1
1: 0
2: 1
3: 1
4: 34
Right 983892049 4:173039752-173039774 CTACAAATTCACATTCCACATGG 0: 1
1: 1
2: 2
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983892044 Original CRISPR ACTATGTAGGGCCTACAAGC AGG (reversed) Intronic
901097756 1:6695905-6695927 ACTATGTAGGGCTTTGCAGCTGG - Intronic
903184910 1:21623324-21623346 ACTCTGTAGGCCCTTCCAGCTGG + Intronic
1116521407 14:45851830-45851852 ACTATGAAGGGCAATCAAGCTGG + Intergenic
1128856713 15:71024043-71024065 ACTAGGTAGGGCCTCCCTGCAGG + Intronic
1150431393 17:65120794-65120816 ACTCTGTAGGGCCAAAACGCTGG - Intergenic
1155578436 18:27275776-27275798 AATATTTAGGGCATACAATCAGG + Intergenic
1164010707 19:21201264-21201286 ACTCGGTAAGGTCTACAAGCAGG + Intergenic
1167983520 19:53296520-53296542 AATATGTAGGGCCTTCAAGCAGG - Intergenic
930062056 2:47298250-47298272 ACTATATATGGTCTAAAAGCAGG + Intergenic
933459192 2:82558542-82558564 ACTATGTTAGGTCTACAAGTGGG - Intergenic
938101752 2:128502279-128502301 ACTAAGGGGGGCCGACAAGCAGG - Intergenic
945689126 2:213010514-213010536 ACTGTGTAGTCCCTAGAAGCAGG - Intronic
1174946866 20:54995782-54995804 ACTATGTAGGGGCTGCCACCCGG + Intergenic
1178923773 21:36758630-36758652 CCTAGGTAGGGGCCACAAGCAGG - Intronic
949996549 3:9621818-9621840 ACCATGCTGGGCCTACAAGTAGG + Intergenic
959275398 3:104271135-104271157 CACATGTAGGGCTTACAAGCAGG - Intergenic
972942092 4:44208326-44208348 ACTATGAAGGACCAACTAGCAGG + Intronic
980202470 4:129674327-129674349 AATATGTAGAGCCAAAAAGCGGG + Intergenic
983892044 4:173039718-173039740 ACTATGTAGGGCCTACAAGCAGG - Intronic
991019452 5:61964730-61964752 ACACTGTGGGGCCTACAAGTGGG - Intergenic
993978019 5:94506197-94506219 ACTATGTAAGGCATTCATGCGGG - Intronic
996796232 5:127351614-127351636 GCTATGTAGTGCCTAGAAGTAGG + Intronic
999179291 5:149657556-149657578 ACTCTGAAGGGCCAAGAAGCAGG - Intergenic
999666368 5:153917232-153917254 ACTATCCAAGGCCCACAAGCTGG + Intergenic
1001860810 5:175053182-175053204 ACTGTGTAGGGACCTCAAGCAGG - Intergenic
1011440306 6:87380355-87380377 TCAATGCAGGGCCTACATGCAGG + Intronic
1023707717 7:42959700-42959722 ATTTTGTAGGGCTAACAAGCAGG + Intergenic
1033564939 7:142569430-142569452 ACTATTCAGGGTCTACAAGATGG + Intergenic
1036474390 8:9079958-9079980 ACTATGCTTGGCCCACAAGCAGG + Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1046431756 8:114135969-114135991 ACTTTGTAGGGCCTAAAGACAGG - Intergenic
1052094677 9:24369747-24369769 ACTAGGTAGGGCCTCCCAGCTGG - Intergenic
1188317518 X:28692499-28692521 ACAATGTAATGCCCACAAGCTGG - Intronic
1192584529 X:72308727-72308749 ACTAGGCAGGGCCCACAATCTGG - Intergenic
1197121398 X:122897700-122897722 ACTATGATGGGGCTACAAGGAGG - Intergenic
1197733419 X:129831527-129831549 CCTTTGTCTGGCCTACAAGCAGG - Intronic
1200048929 X:153418221-153418243 ACTAAGCAGGGTCTTCAAGCAGG + Intergenic