ID: 983892049

View in Genome Browser
Species Human (GRCh38)
Location 4:173039752-173039774
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 272}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983892044_983892049 11 Left 983892044 4:173039718-173039740 CCTGCTTGTAGGCCCTACATAGT 0: 1
1: 0
2: 1
3: 1
4: 34
Right 983892049 4:173039752-173039774 CTACAAATTCACATTCCACATGG 0: 1
1: 1
2: 2
3: 30
4: 272
983892045_983892049 -1 Left 983892045 4:173039730-173039752 CCCTACATAGTGCCAATACAGCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 983892049 4:173039752-173039774 CTACAAATTCACATTCCACATGG 0: 1
1: 1
2: 2
3: 30
4: 272
983892046_983892049 -2 Left 983892046 4:173039731-173039753 CCTACATAGTGCCAATACAGCCT 0: 1
1: 0
2: 0
3: 19
4: 243
Right 983892049 4:173039752-173039774 CTACAAATTCACATTCCACATGG 0: 1
1: 1
2: 2
3: 30
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type