ID: 983892049 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:173039752-173039774 |
Sequence | CTACAAATTCACATTCCACA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 306 | |||
Summary | {0: 1, 1: 1, 2: 2, 3: 30, 4: 272} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
983892044_983892049 | 11 | Left | 983892044 | 4:173039718-173039740 | CCTGCTTGTAGGCCCTACATAGT | 0: 1 1: 0 2: 1 3: 1 4: 34 |
||
Right | 983892049 | 4:173039752-173039774 | CTACAAATTCACATTCCACATGG | 0: 1 1: 1 2: 2 3: 30 4: 272 |
||||
983892045_983892049 | -1 | Left | 983892045 | 4:173039730-173039752 | CCCTACATAGTGCCAATACAGCC | 0: 1 1: 0 2: 0 3: 4 4: 58 |
||
Right | 983892049 | 4:173039752-173039774 | CTACAAATTCACATTCCACATGG | 0: 1 1: 1 2: 2 3: 30 4: 272 |
||||
983892046_983892049 | -2 | Left | 983892046 | 4:173039731-173039753 | CCTACATAGTGCCAATACAGCCT | 0: 1 1: 0 2: 0 3: 19 4: 243 |
||
Right | 983892049 | 4:173039752-173039774 | CTACAAATTCACATTCCACATGG | 0: 1 1: 1 2: 2 3: 30 4: 272 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
983892049 | Original CRISPR | CTACAAATTCACATTCCACA TGG | Intronic | ||