ID: 983892050

View in Genome Browser
Species Human (GRCh38)
Location 4:173039753-173039775
Sequence TACAAATTCACATTCCACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983892044_983892050 12 Left 983892044 4:173039718-173039740 CCTGCTTGTAGGCCCTACATAGT 0: 1
1: 0
2: 1
3: 1
4: 34
Right 983892050 4:173039753-173039775 TACAAATTCACATTCCACATGGG 0: 1
1: 0
2: 2
3: 21
4: 300
983892045_983892050 0 Left 983892045 4:173039730-173039752 CCCTACATAGTGCCAATACAGCC 0: 1
1: 0
2: 0
3: 4
4: 58
Right 983892050 4:173039753-173039775 TACAAATTCACATTCCACATGGG 0: 1
1: 0
2: 2
3: 21
4: 300
983892046_983892050 -1 Left 983892046 4:173039731-173039753 CCTACATAGTGCCAATACAGCCT 0: 1
1: 0
2: 0
3: 19
4: 243
Right 983892050 4:173039753-173039775 TACAAATTCACATTCCACATGGG 0: 1
1: 0
2: 2
3: 21
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983892050 Original CRISPR TACAAATTCACATTCCACAT GGG Intronic