ID: 983892050 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:173039753-173039775 |
Sequence | TACAAATTCACATTCCACAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 324 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 21, 4: 300} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
983892045_983892050 | 0 | Left | 983892045 | 4:173039730-173039752 | CCCTACATAGTGCCAATACAGCC | 0: 1 1: 0 2: 0 3: 4 4: 58 |
||
Right | 983892050 | 4:173039753-173039775 | TACAAATTCACATTCCACATGGG | 0: 1 1: 0 2: 2 3: 21 4: 300 |
||||
983892046_983892050 | -1 | Left | 983892046 | 4:173039731-173039753 | CCTACATAGTGCCAATACAGCCT | 0: 1 1: 0 2: 0 3: 19 4: 243 |
||
Right | 983892050 | 4:173039753-173039775 | TACAAATTCACATTCCACATGGG | 0: 1 1: 0 2: 2 3: 21 4: 300 |
||||
983892044_983892050 | 12 | Left | 983892044 | 4:173039718-173039740 | CCTGCTTGTAGGCCCTACATAGT | 0: 1 1: 0 2: 1 3: 1 4: 34 |
||
Right | 983892050 | 4:173039753-173039775 | TACAAATTCACATTCCACATGGG | 0: 1 1: 0 2: 2 3: 21 4: 300 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
983892050 | Original CRISPR | TACAAATTCACATTCCACAT GGG | Intronic | ||