ID: 983893829 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:173059926-173059948 |
| Sequence | CAGTTTGAATACATGTATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 983893829_983893831 | -3 | Left | 983893829 | 4:173059926-173059948 | CCAAGATACATGTATTCAAACTG | No data | ||
| Right | 983893831 | 4:173059946-173059968 | CTGGACAAAGCATCATAAATTGG | No data | ||||
| 983893829_983893832 | 16 | Left | 983893829 | 4:173059926-173059948 | CCAAGATACATGTATTCAAACTG | No data | ||
| Right | 983893832 | 4:173059965-173059987 | TTGGTCTAAGAAAATAAAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 983893829 | Original CRISPR | CAGTTTGAATACATGTATCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||