ID: 983893829

View in Genome Browser
Species Human (GRCh38)
Location 4:173059926-173059948
Sequence CAGTTTGAATACATGTATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983893829_983893831 -3 Left 983893829 4:173059926-173059948 CCAAGATACATGTATTCAAACTG No data
Right 983893831 4:173059946-173059968 CTGGACAAAGCATCATAAATTGG No data
983893829_983893832 16 Left 983893829 4:173059926-173059948 CCAAGATACATGTATTCAAACTG No data
Right 983893832 4:173059965-173059987 TTGGTCTAAGAAAATAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983893829 Original CRISPR CAGTTTGAATACATGTATCT TGG (reversed) Intergenic
No off target data available for this crispr