ID: 983895244

View in Genome Browser
Species Human (GRCh38)
Location 4:173074491-173074513
Sequence TCTTCCCTAAAGCAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983895241_983895244 16 Left 983895241 4:173074452-173074474 CCACTTAGGAATTCAAGGTCAGG No data
Right 983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983895244 Original CRISPR TCTTCCCTAAAGCAGATGGA TGG Intergenic
No off target data available for this crispr