ID: 983898964

View in Genome Browser
Species Human (GRCh38)
Location 4:173113054-173113076
Sequence TGGGCAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983898958_983898964 -8 Left 983898958 4:173113039-173113061 CCTGTTCCTCCTCACTGGGCAGG 0: 8
1: 31
2: 124
3: 259
4: 630
Right 983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG No data
983898955_983898964 -3 Left 983898955 4:173113034-173113056 CCAGTCCTGTTCCTCCTCACTGG No data
Right 983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG No data
983898952_983898964 22 Left 983898952 4:173113009-173113031 CCACACTGCTTCTTAAAGTGGGT No data
Right 983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG No data
983898954_983898964 -2 Left 983898954 4:173113033-173113055 CCCAGTCCTGTTCCTCCTCACTG No data
Right 983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG No data
983898953_983898964 -1 Left 983898953 4:173113032-173113054 CCCCAGTCCTGTTCCTCCTCACT No data
Right 983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983898964 Original CRISPR TGGGCAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr