ID: 983899437

View in Genome Browser
Species Human (GRCh38)
Location 4:173118056-173118078
Sequence GTCAAAGATCAGATGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6507
Summary {0: 416, 1: 1474, 2: 1581, 3: 1564, 4: 1472}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983899437_983899440 2 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899440 4:173118081-173118103 AACCAACAGAAACAAGCAATGGG No data
983899437_983899443 8 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899443 4:173118087-173118109 CAGAAACAAGCAATGGGGAAAGG 0: 91
1: 4404
2: 12332
3: 5554
4: 3208
983899437_983899441 3 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899441 4:173118082-173118104 ACCAACAGAAACAAGCAATGGGG No data
983899437_983899439 1 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899439 4:173118080-173118102 AAACCAACAGAAACAAGCAATGG No data
983899437_983899444 27 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983899437 Original CRISPR GTCAAAGATCAGATGGTTGT AGG (reversed) Intergenic
Too many off-targets to display for this crispr