ID: 983899438

View in Genome Browser
Species Human (GRCh38)
Location 4:173118063-173118085
Sequence TGGTTTTGTCAAAGATCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983899438_983899446 26 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899446 4:173118112-173118134 TCCCTGTCAATAAATGGTGTGGG No data
983899438_983899445 25 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899445 4:173118111-173118133 TTCCCTGTCAATAAATGGTGTGG No data
983899438_983899439 -6 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899439 4:173118080-173118102 AAACCAACAGAAACAAGCAATGG No data
983899438_983899443 1 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899443 4:173118087-173118109 CAGAAACAAGCAATGGGGAAAGG 0: 91
1: 4404
2: 12332
3: 5554
4: 3208
983899438_983899441 -4 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899441 4:173118082-173118104 ACCAACAGAAACAAGCAATGGGG No data
983899438_983899448 27 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899448 4:173118113-173118135 CCCTGTCAATAAATGGTGTGGGG No data
983899438_983899440 -5 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899440 4:173118081-173118103 AACCAACAGAAACAAGCAATGGG No data
983899438_983899444 20 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983899438 Original CRISPR TGGTTTTGTCAAAGATCAGA TGG (reversed) Intergenic
No off target data available for this crispr