ID: 983899442

View in Genome Browser
Species Human (GRCh38)
Location 4:173118083-173118105
Sequence TCCCCATTGCTTGTTTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983899442_983899444 0 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data
983899442_983899450 15 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899450 4:173118121-173118143 ATAAATGGTGTGGGGATTACTGG No data
983899442_983899448 7 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899448 4:173118113-173118135 CCCTGTCAATAAATGGTGTGGGG No data
983899442_983899446 6 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899446 4:173118112-173118134 TCCCTGTCAATAAATGGTGTGGG No data
983899442_983899445 5 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899445 4:173118111-173118133 TTCCCTGTCAATAAATGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983899442 Original CRISPR TCCCCATTGCTTGTTTCTGT TGG (reversed) Intergenic
No off target data available for this crispr