ID: 983899444

View in Genome Browser
Species Human (GRCh38)
Location 4:173118106-173118128
Sequence AAGGATTCCCTGTCAATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983899438_983899444 20 Left 983899438 4:173118063-173118085 CCATCTGATCTTTGACAAAACCA No data
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data
983899437_983899444 27 Left 983899437 4:173118056-173118078 CCTACAACCATCTGATCTTTGAC 0: 416
1: 1474
2: 1581
3: 1564
4: 1472
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data
983899442_983899444 0 Left 983899442 4:173118083-173118105 CCAACAGAAACAAGCAATGGGGA No data
Right 983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983899444 Original CRISPR AAGGATTCCCTGTCAATAAA TGG Intergenic
No off target data available for this crispr