ID: 983899902

View in Genome Browser
Species Human (GRCh38)
Location 4:173122673-173122695
Sequence GTGTGAACTCAGGTGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983899893_983899902 26 Left 983899893 4:173122624-173122646 CCGGGCTCACAGTCAACTTGAGT No data
Right 983899902 4:173122673-173122695 GTGTGAACTCAGGTGGAACCAGG No data
983899899_983899902 -8 Left 983899899 4:173122658-173122680 CCAGATGAGGCATGGGTGTGAAC No data
Right 983899902 4:173122673-173122695 GTGTGAACTCAGGTGGAACCAGG No data
983899897_983899902 -1 Left 983899897 4:173122651-173122673 CCATGAGCCAGATGAGGCATGGG No data
Right 983899902 4:173122673-173122695 GTGTGAACTCAGGTGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983899902 Original CRISPR GTGTGAACTCAGGTGGAACC AGG Intergenic
No off target data available for this crispr