ID: 983900518

View in Genome Browser
Species Human (GRCh38)
Location 4:173128599-173128621
Sequence TAAGGCTTCCCCAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983900518_983900528 27 Left 983900518 4:173128599-173128621 CCAGCTTCCCTGGGGAAGCCTTA No data
Right 983900528 4:173128649-173128671 CAGCCCCAGCTCCTAAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983900518 Original CRISPR TAAGGCTTCCCCAGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr