ID: 983901021

View in Genome Browser
Species Human (GRCh38)
Location 4:173134409-173134431
Sequence CTGATGTGGGCCAAAGATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983901021_983901027 1 Left 983901021 4:173134409-173134431 CCTTAATCTTTGGCCCACATCAG No data
Right 983901027 4:173134433-173134455 GCAATTAAACTAATTCATCAGGG No data
983901021_983901026 0 Left 983901021 4:173134409-173134431 CCTTAATCTTTGGCCCACATCAG No data
Right 983901026 4:173134432-173134454 GGCAATTAAACTAATTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983901021 Original CRISPR CTGATGTGGGCCAAAGATTA AGG (reversed) Intergenic
No off target data available for this crispr