ID: 983901027

View in Genome Browser
Species Human (GRCh38)
Location 4:173134433-173134455
Sequence GCAATTAAACTAATTCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983901021_983901027 1 Left 983901021 4:173134409-173134431 CCTTAATCTTTGGCCCACATCAG No data
Right 983901027 4:173134433-173134455 GCAATTAAACTAATTCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983901027 Original CRISPR GCAATTAAACTAATTCATCA GGG Intergenic
No off target data available for this crispr