ID: 983904451

View in Genome Browser
Species Human (GRCh38)
Location 4:173169253-173169275
Sequence GCCCGCTCCGCCCGCAGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 263}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983904451_983904469 28 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904469 4:173169304-173169326 GCCCGGCGTCCCGCTCTGGGGGG 0: 1
1: 0
2: 2
3: 23
4: 545
983904451_983904459 -3 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904459 4:173169273-173169295 GGCGGAGAGCCGGGTCCGGGGGG No data
983904451_983904468 27 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904468 4:173169303-173169325 CGCCCGGCGTCCCGCTCTGGGGG No data
983904451_983904458 -4 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904458 4:173169272-173169294 GGGCGGAGAGCCGGGTCCGGGGG 0: 1
1: 0
2: 5
3: 36
4: 355
983904451_983904462 11 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904462 4:173169287-173169309 TCCGGGGGGCTGCGGCCGCCCGG 0: 1
1: 0
2: 2
3: 26
4: 270
983904451_983904460 3 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904460 4:173169279-173169301 GAGCCGGGTCCGGGGGGCTGCGG 0: 1
1: 0
2: 2
3: 39
4: 499
983904451_983904465 25 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904465 4:173169301-173169323 GCCGCCCGGCGTCCCGCTCTGGG No data
983904451_983904457 -5 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904457 4:173169271-173169293 CGGGCGGAGAGCCGGGTCCGGGG 0: 1
1: 0
2: 1
3: 13
4: 248
983904451_983904456 -6 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904456 4:173169270-173169292 GCGGGCGGAGAGCCGGGTCCGGG 0: 1
1: 1
2: 1
3: 33
4: 290
983904451_983904464 24 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904464 4:173169300-173169322 GGCCGCCCGGCGTCCCGCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 117
983904451_983904467 26 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904467 4:173169302-173169324 CCGCCCGGCGTCCCGCTCTGGGG 0: 1
1: 0
2: 1
3: 5
4: 93
983904451_983904455 -7 Left 983904451 4:173169253-173169275 CCGGGACTGCGGGCGGAGCGGGC 0: 1
1: 0
2: 1
3: 22
4: 263
Right 983904455 4:173169269-173169291 AGCGGGCGGAGAGCCGGGTCCGG 0: 1
1: 1
2: 1
3: 17
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983904451 Original CRISPR GCCCGCTCCGCCCGCAGTCC CGG (reversed) Intronic
900091747 1:923864-923886 GCCCGCGCCGCCCGCCGCGCCGG + Intergenic
900103202 1:971523-971545 GCCCACCCAGCCCGCGGTCCTGG + Intronic
900104713 1:977083-977105 TCCCGCTCCCCCCGCAACCCCGG + Intronic
900104993 1:977686-977708 TCCCGCTCCCCCCGCAACCCCGG + Intronic
900115099 1:1024951-1024973 GCCCGCTCAGCCGCCAGCCCTGG - Intronic
900366726 1:2314700-2314722 GCCCGTTCCGTTCCCAGTCCGGG + Intergenic
900552056 1:3261765-3261787 GCCTGCCCCGCCCTCCGTCCTGG + Intronic
900866511 1:5272698-5272720 CCCTGCTCCGCCCCCATTCCAGG - Intergenic
900995952 1:6123929-6123951 GCCCGCCCAGCCCACAGACCTGG + Exonic
901934565 1:12618574-12618596 GCCCGGGCCGCCCGCGGGCCAGG + Intergenic
902415612 1:16237042-16237064 GCCCTCCCCGTCAGCAGTCCCGG + Exonic
902719090 1:18292218-18292240 GCCAGCTCCTCCAACAGTCCTGG + Intronic
904006627 1:27366468-27366490 GCCGGCTCCGCGCGCAGCCCCGG + Exonic
904245127 1:29181987-29182009 GCAAGCTCCTCCCCCAGTCCTGG - Exonic
906083211 1:43107707-43107729 GCCGGCTCCCCCAGCAGTGCTGG - Intergenic
907051094 1:51330393-51330415 GCCCGCGCCGCCCGCGCCCCCGG + Intronic
908132188 1:61083803-61083825 GGCCGCTCCGCGCGCAGGACGGG + Intronic
915214125 1:154328839-154328861 GCGCGCCCCACCCGCAGCCCAGG - Intronic
916210433 1:162355736-162355758 GCCCGCTCTGCCTGCAGTAGCGG + Intronic
916940133 1:169668417-169668439 GCCAGCTCCACCAGCAGCCCCGG + Intronic
918058970 1:181045853-181045875 GCAAGCGCCGCCCGCAGCCCGGG - Intronic
918542623 1:185648886-185648908 GGCAGCTCCACCCGCAGTCCTGG - Intergenic
919091976 1:192987315-192987337 GGCAGCTCCACCCGCAGCCCTGG + Intergenic
920882064 1:209889281-209889303 GCAAGCGCCGCGCGCAGTCCCGG + Intergenic
921325282 1:213982661-213982683 GCACGCCCCTCCCGCGGTCCCGG + Intergenic
921903881 1:220476036-220476058 GCAAGCTCCGCACGCAGCCCCGG + Intergenic
922496520 1:226062276-226062298 GCCCGAGACGCCCGCAGGCCGGG + Intronic
922821285 1:228487470-228487492 GGCCCCGCCGCCCGCAGCCCTGG + Exonic
922985948 1:229865862-229865884 GGCAGCTCCACCCGCAGCCCTGG + Intergenic
1063848779 10:10161299-10161321 GGCAGCTCCGCCTGCAGCCCTGG + Intergenic
1065214784 10:23439193-23439215 GTGCGCTCGGCCCGCAGACCCGG - Intergenic
1065883864 10:30059620-30059642 GCCCGCCCCGCCCACCGCCCGGG + Intronic
1066436178 10:35398200-35398222 GCCAGCTCTGCCCACAGTCGGGG - Intronic
1066613542 10:37275280-37275302 GGCAGCTCCGCCCACAGCCCTGG - Intronic
1066614996 10:37285122-37285144 GGCAGCTCCGCCCGCAGCCCTGG - Intronic
1067878098 10:50021753-50021775 GCCCACTGCTCCCCCAGTCCAGG - Intergenic
1068956024 10:62818948-62818970 CCCCGCCCCGCCCCCAGCCCCGG - Intronic
1069766217 10:70862067-70862089 GGCAGCTCCACCCGCAGCCCCGG + Intronic
1070570745 10:77638008-77638030 CCCGGCTCCGCGCGCGGTCCCGG + Intronic
1071041016 10:81309029-81309051 GGCAGCTCCACCTGCAGTCCCGG - Intergenic
1072970039 10:100009755-100009777 GTCCCCTCCGCCCGCGGCCCCGG + Intronic
1075396628 10:122132636-122132658 GCCCGCTGCCCCCGCAGACCTGG + Exonic
1075438390 10:122461411-122461433 GCCCCCTCCGCGGGCGGTCCCGG + Intergenic
1075724330 10:124603824-124603846 GCCAGCTCTGCCCACAGGCCTGG - Intronic
1076622784 10:131803231-131803253 CCCCGCTCCGGCCCCACTCCAGG - Intergenic
1077495565 11:2885033-2885055 GTCCACCCCGCCCCCAGTCCCGG - Exonic
1077497369 11:2892663-2892685 GCCCTATCCCCCCGCAGGCCCGG + Intronic
1078548334 11:12262602-12262624 GTCCTCTCCGCCAGCAGTACTGG + Intronic
1082009570 11:47441231-47441253 GACAGCTCTGCCCGCAGCCCTGG - Intronic
1082924692 11:58532349-58532371 GGCAGCTCCGCCCGCAGCCCTGG + Intronic
1084588748 11:70078434-70078456 TCCCGCTCCGCCCGCCGCCCTGG - Exonic
1084758007 11:71251523-71251545 GCCCGCCCAGCCCGCGGCCCAGG - Intronic
1084888382 11:72224675-72224697 CTCCGCTCGGCCCGCAGCCCGGG - Intronic
1091303337 11:134521765-134521787 CCCTGCTCCGCCCTCACTCCAGG - Intergenic
1092253527 12:6914535-6914557 GCCTCCTCCGCCCGCCGCCCGGG + Intronic
1092272893 12:7037444-7037466 GCAAGCGCCGCACGCAGTCCGGG - Intronic
1094000221 12:25686659-25686681 GGCAGCTCTGCCCGCAGCCCTGG + Intergenic
1096102592 12:48978707-48978729 GGCCGCTCTGCCCGCAGCCCTGG + Exonic
1096309177 12:50505192-50505214 GCCAGCTGCGCCCGCACTTCAGG - Exonic
1096372769 12:51083093-51083115 GCGAGCTGCCCCCGCAGTCCGGG + Intronic
1104866988 12:131961527-131961549 CCCCGCTGCGCCCCCAGCCCCGG - Exonic
1104885537 12:132104895-132104917 CCCCGCTGCGCCCCCAGCCCCGG - Exonic
1105725747 13:23160435-23160457 GCCAGCACCGCCCGGAGTCCGGG + Intergenic
1107058446 13:36131028-36131050 GCCCGCTCCGCCCGCAGCCGCGG - Intronic
1110450654 13:75635692-75635714 CCCCGCTCCGCCCGGCTTCCAGG - Intronic
1112091841 13:96090997-96091019 GGCCGGCCCGCCCGCCGTCCCGG + Exonic
1112506805 13:99980687-99980709 TCCCGCCCCGCCCGCCCTCCCGG - Intergenic
1114418098 14:22557385-22557407 ACCCGCTCCACCCGGAGCCCTGG + Intronic
1119223825 14:72929057-72929079 GTCCGTGCCGCCCGCAGTGCTGG - Intronic
1119786887 14:77320818-77320840 GCCCGCCCCGCCCCGAGCCCGGG - Exonic
1120174147 14:81275759-81275781 GCCAGCTCCCCAGGCAGTCCAGG - Intronic
1120209864 14:81623963-81623985 GCCCGGTCCCCCAGCAGTGCTGG - Intergenic
1120787982 14:88554614-88554636 GCCCGCCCCTCCCGCCGGCCGGG + Intronic
1121145469 14:91578380-91578402 GGCAGCTCCGCCCGCGGCCCTGG + Intergenic
1121243011 14:92443311-92443333 GCCTCCTCCCCCCGCAGTGCAGG - Intronic
1122082131 14:99273575-99273597 CCCCACTCCGCCCCCAGGCCTGG + Intergenic
1123048191 14:105528394-105528416 GCCCGCGCCGCCCTCCCTCCTGG - Intronic
1125371643 15:38984008-38984030 GCCCTCTCCGCTCCCTGTCCAGG - Intergenic
1125677572 15:41511177-41511199 GCCGCCTCCGCCCGCAGTGCAGG + Exonic
1128067656 15:64774974-64774996 GCGCGCGCCGGCCGCCGTCCGGG - Intronic
1131212662 15:90510978-90511000 GCAAGCACCGCGCGCAGTCCCGG - Intergenic
1132475949 16:138280-138302 GCCCCCTCCGCCCCCGGCCCCGG - Exonic
1132519710 16:381641-381663 TCCCGCCCCGCCCGCAGCCCCGG + Intronic
1132653464 16:1031780-1031802 GGCCGCTGTGCCCGCAATCCAGG - Intergenic
1132685085 16:1158849-1158871 CCCCGCTCAGCCCGCACCCCTGG + Intronic
1132685100 16:1158883-1158905 CCCCGCTCAGCCCGCACCCCTGG + Intronic
1133020988 16:2966893-2966915 GCCGGCCCCGCCCGCAGTGTCGG + Exonic
1134684622 16:16150077-16150099 GCCCGCACAGCCTGCAGTGCTGG - Exonic
1136462037 16:30417569-30417591 GCCCGCGCCGTCCGCCGACCCGG + Exonic
1137300501 16:47143905-47143927 GGCAGCTCCGCCCGCGGCCCCGG + Exonic
1137426508 16:48385171-48385193 GCCGGCTCCTCCCTCAGGCCGGG + Intronic
1137531587 16:49281812-49281834 GCCCGCTCCGGCTGCAGCGCCGG - Exonic
1138384286 16:56625671-56625693 GTCCGCACCGCCCGCGTTCCTGG - Exonic
1138390686 16:56668154-56668176 GTCCGCACCGCCCGCGGTCCCGG + Intronic
1138390982 16:56669703-56669725 GTCCGAGCCGCCCGCGGTCCTGG - Intronic
1139402771 16:66696059-66696081 GTCCGCTCCGCCCTCGCTCCCGG - Intronic
1141683395 16:85556749-85556771 GCCCCCCCCCCCCCCAGTCCTGG + Intergenic
1142120184 16:88383220-88383242 GCCCGCTCCGCCCGCCACGCCGG - Intergenic
1143132092 17:4685303-4685325 GCCCCCCCAGCCCGCAATCCCGG + Intronic
1143747224 17:9003432-9003454 GCGCGCTCTGGCCGCGGTCCCGG + Intergenic
1146256009 17:31391848-31391870 GCCCGCGCCGCCCGCCATCCGGG - Exonic
1146650609 17:34603889-34603911 GCCCCCTCCGCCACCAGGCCTGG + Intronic
1147134774 17:38428517-38428539 TCCCGCCCCGCCCGGAGCCCCGG + Exonic
1148201239 17:45751263-45751285 GCCCTCTCCCTCCGCATTCCCGG - Intergenic
1148366213 17:47057624-47057646 GCAAGCACCGCACGCAGTCCCGG + Intergenic
1150235783 17:63591790-63591812 GGCTGCTCCTCCCGCAGTCAGGG - Exonic
1151732988 17:75921917-75921939 TCCCACTCAGCCCGCAGCCCAGG + Intronic
1151840572 17:76614871-76614893 GGCAGCTCCGCCTGCAGTTCTGG - Intergenic
1152831035 17:82497161-82497183 GCCAGCTCCGTCCGCAAACCCGG - Intergenic
1153457195 18:5295201-5295223 CCCCGCTCCGCCCGCGAGCCCGG + Intronic
1154303992 18:13217792-13217814 GCCCGCTCCGCGCGCCGCCGCGG + Intronic
1157464186 18:47930511-47930533 TCCCGCCCCGCCCCCAGGCCCGG + Exonic
1158954027 18:62523208-62523230 GCACGCCCCGCCCCCAGCCCGGG + Exonic
1159770395 18:72541766-72541788 GCCCACCCCGCCCCCAGCCCGGG - Intronic
1160727242 19:622778-622800 GCCCGCCCCGCCCGGGGACCCGG + Intronic
1160793370 19:933084-933106 GCCCGCATCGCCCGCAGGCCTGG - Intronic
1160858441 19:1227644-1227666 GCCGGTTCCGCCCGCCCTCCCGG + Exonic
1160967710 19:1753856-1753878 GCCCGCGCCGCCCGCGCCCCCGG - Exonic
1160970436 19:1765473-1765495 GCCAGCTCCGCTCTGAGTCCAGG - Intronic
1161237538 19:3205311-3205333 TCCCCCAGCGCCCGCAGTCCCGG + Intronic
1161264984 19:3359867-3359889 GCCAGCTCCGCCCCCAGCCGGGG - Intronic
1161401323 19:4067200-4067222 GCCCGCTCCCCCCGCGCCCCGGG - Intergenic
1161504464 19:4636391-4636413 GCGCGCTCTGCCCACAGCCCGGG - Intergenic
1162369674 19:10271180-10271202 GCCCGCGCTGCCCGCACTCCTGG + Exonic
1162410499 19:10502655-10502677 GCCCGCGATGCCCGCAGCCCGGG + Intronic
1164643563 19:29843274-29843296 GCCTCCTCCGCCGCCAGTCCGGG + Intergenic
1165065731 19:33226828-33226850 GCTCGCCCCGCCCGCCGCCCCGG - Intergenic
1165420723 19:35720773-35720795 TCCCGCTCCGCCCGCTGGCTGGG - Exonic
1165434744 19:35789679-35789701 ACCCCCTCCGCCCGCCCTCCAGG - Intergenic
1165833873 19:38743264-38743286 GCCCCCTCCTCCCTCAGACCCGG + Intronic
1166214785 19:41327849-41327871 GCCAGCTCAGCCGGCAGCCCTGG + Intronic
1166245403 19:41522157-41522179 CCACGCTGCGCCCGCTGTCCCGG - Intergenic
1166737212 19:45093243-45093265 TCCGGGTCCGCCCGCCGTCCCGG - Exonic
1166843416 19:45712424-45712446 GCCCCCTCCGCCCCCTGCCCGGG - Exonic
1167286111 19:48599669-48599691 GCCCTCTCCTCCCTCAGACCCGG - Intergenic
1167752818 19:51390883-51390905 GCCCCCTCCTCCCTCAGACCCGG + Intergenic
1167752867 19:51391032-51391054 GCCCCCTCCTCCCTCAGACCCGG + Intergenic
1168069733 19:53942826-53942848 GCTTGCTCCACCCGCAGCCCCGG + Exonic
1168283796 19:55320697-55320719 GCCCCCTCCACCCTCAGACCAGG + Intronic
1168307319 19:55442654-55442676 GCCCGCCCCGCCCGCGGGGCCGG + Exonic
925836418 2:7951180-7951202 GCCCGCTGCGCCAGCAGAGCTGG - Intergenic
926616561 2:15002488-15002510 GGCAGCTCCACCTGCAGTCCCGG - Intergenic
927215774 2:20667205-20667227 GCCCGCGCCGCCCGCCCGCCCGG + Exonic
927714125 2:25341656-25341678 GCCGTCCCCGCCTGCAGTCCCGG + Intronic
935149045 2:100417449-100417471 GCGCGCTTCGCCCACAGGCCCGG - Exonic
935790280 2:106584438-106584460 GCAAGCACCGCCCTCAGTCCCGG - Intergenic
936370639 2:111899199-111899221 CCCCGCTCTGGCCGGAGTCCCGG + Intronic
937596916 2:123684182-123684204 GGCCGCTCCACCTGCAGCCCCGG + Intergenic
939275245 2:139991040-139991062 GCAAGCACCGCGCGCAGTCCCGG + Intergenic
942681366 2:178480682-178480704 CCACGCTGCGCCCGCTGTCCCGG + Exonic
945744290 2:213701633-213701655 GGCAGCTCCACCCGCAGCCCTGG + Intronic
946692479 2:222319730-222319752 GCCCGCCGCGCCCGCCGCCCTGG - Intergenic
947566698 2:231198726-231198748 CCACCCTCCGCCCGCCGTCCTGG + Intronic
947636098 2:231681340-231681362 GCCCGCCCCGGGCGCACTCCGGG + Intergenic
947718180 2:232352171-232352193 GCCGGGTGCGCCCGGAGTCCTGG + Intergenic
947720387 2:232366359-232366381 GCAAGCTCCGCGCGCAGCCCTGG - Intergenic
947962118 2:234248082-234248104 GGCAGCTCCGCCTGCGGTCCTGG + Intergenic
948942690 2:241204070-241204092 GCCGGCCCCGCCCGCTGCCCTGG - Intronic
1169483511 20:6006476-6006498 GCCCGCTCCGGCCGCTGGCCTGG - Exonic
1173195651 20:40911202-40911224 GCAAGCTCCGCACGCAGCCCTGG - Intergenic
1173649128 20:44651794-44651816 CCCCGCCCCGCCCGCCGGCCTGG + Intronic
1173734250 20:45348285-45348307 CCCCGCTTCGCCCCCAGCCCGGG + Intronic
1175524274 20:59622768-59622790 GCCGGCTCCCCCAGCAGCCCAGG - Intronic
1175891204 20:62316813-62316835 GCCTGCACCTCCCGCAGCCCCGG - Intronic
1175950833 20:62582273-62582295 GCCCCCTGCCCCCGCACTCCGGG + Intergenic
1176161319 20:63650432-63650454 GCCCACCCCTCCCGCCGTCCAGG + Intronic
1176161338 20:63650488-63650510 GCCCACCCCTCCCGCCGTCCAGG + Intronic
1176161435 20:63650758-63650780 GCCCACCCCTCCCGCCGTCCAGG + Intronic
1176952433 21:15064207-15064229 GGCCGCTCTGCCCGCACTCGCGG - Intronic
1176966547 21:15218529-15218551 GGCAGCTCCACCTGCAGTCCCGG - Intergenic
1177875492 21:26626354-26626376 GCCCCCTCCACCCACAGTCTTGG - Intergenic
1179163106 21:38913625-38913647 GACCGCTCCGCCCACCGCCCAGG + Intergenic
1179810058 21:43864866-43864888 CCCCGCGCCCCCCGCGGTCCCGG + Intergenic
1180037717 21:45258266-45258288 GCCCACCCCTCCCGCGGTCCTGG + Intergenic
1180707005 22:17816301-17816323 CCCAGCTCCGCCAGCAGCCCTGG + Intronic
1180831091 22:18906481-18906503 GCCCGCCCCGCCCGCGTACCTGG - Exonic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1180949408 22:19714450-19714472 GCCCGCTCCGCCCGCGCGCCCGG - Exonic
1182278671 22:29205946-29205968 GCCCGCGCCGCCAGCCGCCCCGG - Exonic
1183272422 22:36870515-36870537 GCCGGCTCCGCCCGCGCACCCGG + Exonic
1184058051 22:42065821-42065843 GCACGCTCCACCAGGAGTCCTGG + Exonic
1184366633 22:44055996-44056018 GGCCGCTCCCCACCCAGTCCAGG + Intronic
1184697962 22:46150376-46150398 GCCCGCCCCGCGCGCCCTCCGGG - Intergenic
1185291891 22:50031441-50031463 GGCCGCTCCGCCCGCACGCCTGG + Intronic
1185296753 22:50058426-50058448 GCCTGCTCCGACAGCAGCCCGGG - Intergenic
1203281178 22_KI270734v1_random:131752-131774 GCCCGCCCCGCCCGCGTACCTGG - Intergenic
950929363 3:16773736-16773758 GCAAGCGCCGCCCGCAGCCCCGG - Intergenic
951323133 3:21271582-21271604 GGCAGCTCCGCCCGCAGCCCTGG - Intergenic
951551805 3:23882485-23882507 GGCAGCTCCGCCCGCAGCCCCGG - Intronic
953397024 3:42581722-42581744 GCCCACCCGGCCCTCAGTCCCGG - Intronic
953638687 3:44685497-44685519 GCCAGCGCAGCCCGCAGCCCCGG + Intergenic
954752119 3:52819593-52819615 GCCCTCTCCGCACCCACTCCTGG - Exonic
954912598 3:54122085-54122107 GCCCGCTCCGCCCCTGGGCCGGG - Intergenic
961300085 3:125916553-125916575 GCCCGCCCCGTCTTCAGTCCAGG + Intergenic
964378500 3:156073180-156073202 GCAAGCACCGCCCGCAGCCCCGG - Intronic
968319061 3:197749820-197749842 CCCCGCCCCGCCCGCAGCCGCGG + Exonic
968515080 4:1012344-1012366 GCCCTCCCCGCCCGCGCTCCAGG - Intronic
968642602 4:1721886-1721908 GCCCGCTCCGCCGTCGGTCTTGG - Intronic
969116131 4:4871823-4871845 GCCTGCTCCGCCTGCCCTCCTGG + Intergenic
969317236 4:6389616-6389638 GCCCCCTCCTCACGGAGTCCAGG + Intronic
971563529 4:28112799-28112821 GCAAGCTCCGCGCGCAGCCCCGG - Intergenic
971852062 4:31996408-31996430 GCAAGCACCGCGCGCAGTCCGGG - Intergenic
973045456 4:45530860-45530882 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
973551236 4:52038124-52038146 GCCCGCGCCCCCCGCACCCCCGG + Intronic
975160789 4:71121378-71121400 GGCAGCTCCGCCCGCGGCCCTGG + Intergenic
975986176 4:80202901-80202923 GCCCGCGCCGCCTGCGGCCCCGG - Exonic
978466326 4:109012879-109012901 GGCAGCTCCGCCAGCAGCCCTGG + Intronic
983834169 4:172369434-172369456 GGCAGCTCCACCCGCAGCCCTGG - Intronic
983904451 4:173169253-173169275 GCCCGCTCCGCCCGCAGTCCCGG - Intronic
984918176 4:184741611-184741633 GGCAGCTCCGCCTGCAGCCCTGG + Intergenic
986132354 5:4943040-4943062 ACCAGCTCCTCCCGCAGTGCGGG - Intergenic
986919097 5:12662311-12662333 GGCCGCTCTGCCCACAGCCCTGG + Intergenic
987128016 5:14833507-14833529 GCCTGCTCCTCCCCCAGTCTGGG + Intronic
988020454 5:25614519-25614541 GGCAGCTCCGCCGGCAGCCCTGG - Intergenic
991642968 5:68772917-68772939 TCCCGCTGTGCCCGCTGTCCTGG + Intergenic
992795957 5:80255637-80255659 CCCCGCTCCACGCGGAGTCCCGG + Intronic
994167072 5:96618868-96618890 GGCAGCTCTGCCCGCAGCCCCGG + Intronic
994570370 5:101506436-101506458 GGCAGCTCCGCCCGCAGCCCTGG + Intergenic
997652945 5:135535745-135535767 GGCGGCTCTGCCCTCAGTCCGGG - Exonic
1000062721 5:157671260-157671282 ACCCGCCCCGCCAGCAGGCCGGG + Intronic
1000568643 5:162882879-162882901 GGCAGCTCTGCCCGCAGCCCTGG + Intergenic
1002099762 5:176851595-176851617 GCCAGCCCCGCCCCCAGCCCAGG - Intronic
1002184230 5:177446867-177446889 GCCGCCTCCCCCCGCAGGCCCGG + Exonic
1002185906 5:177454743-177454765 GCCCGCGCCCTGCGCAGTCCGGG - Intronic
1004053080 6:12108342-12108364 GGCAGCTCCACCTGCAGTCCTGG - Intronic
1004665559 6:17745647-17745669 GCAAGCGCCGCACGCAGTCCCGG + Intergenic
1005463127 6:26087723-26087745 GCCCCCTCCCCCGGCTGTCCCGG + Intronic
1006373696 6:33660067-33660089 GCTCCCTCTGCCCTCAGTCCTGG - Intronic
1007390329 6:41546787-41546809 GCTCGCTCCGGTCGCAGCCCGGG - Exonic
1007614262 6:43171336-43171358 GCCCCCTCCACCCGCCGTCTCGG + Exonic
1010141503 6:72620181-72620203 GCCCCCTCCGCCTTCAGTCAGGG + Intergenic
1011633870 6:89352704-89352726 TGCCACCCCGCCCGCAGTCCAGG - Exonic
1014788438 6:125644472-125644494 GCAAGCGCCGCCCGCAGCCCTGG - Intergenic
1017470593 6:154733962-154733984 GCCCGCACCGCCCCCACCCCTGG + Intronic
1019111945 6:169724050-169724072 GCCCCCTCCGCCCGCCCGCCCGG + Exonic
1019190785 6:170249427-170249449 TCCCGCTCTGCCCACAGCCCTGG - Intergenic
1019341821 7:512099-512121 GCCTGCTCCTCCTGGAGTCCTGG - Intronic
1021558549 7:21945905-21945927 GCGCGCTCCGCCCGGAGCACAGG + Exonic
1022750400 7:33218994-33219016 GCAAGCGCCGCCCGCAGCCCGGG - Intronic
1023823750 7:43995041-43995063 ACACGCTCCTCCCACAGTCCTGG + Intergenic
1024578284 7:50782342-50782364 GGCCGATCCGCCCGCCGCCCCGG + Intronic
1024700671 7:51901235-51901257 GCAAGCGCCGCACGCAGTCCCGG + Intergenic
1024965488 7:55019513-55019535 TCCCGTTCCTCCCGCGGTCCCGG - Intronic
1026471151 7:70694744-70694766 GCGCGCTCCTCCCGCCGCCCGGG + Intronic
1027361687 7:77416251-77416273 GCCCGCTGCGCCCGCAACCACGG + Exonic
1029037965 7:97541531-97541553 GGCAGCTCCGCCCGTAGCCCTGG + Intergenic
1029425921 7:100493928-100493950 GCCCGCCCCCTCCCCAGTCCAGG - Exonic
1030106432 7:105991109-105991131 CCCCTCTCTGCCCCCAGTCCTGG - Intronic
1030780484 7:113593726-113593748 GGCAGCTCCACCTGCAGTCCCGG + Intergenic
1032062790 7:128739081-128739103 GCCCACGCCACCCGCAGTACGGG + Intergenic
1032086295 7:128885535-128885557 GCCCGCACCGGCCACAGACCTGG + Intronic
1034100285 7:148445174-148445196 GGCAGCTCCGCCTGTAGTCCAGG - Intergenic
1035431953 7:158829297-158829319 GCCAGCTGCGCCAGCAGCCCGGG + Exonic
1035630190 8:1101518-1101540 GCCCCCTCCACCCCCAGCCCCGG - Intergenic
1039949016 8:42153273-42153295 GTCCCCTCCGCCCGCAGCCGCGG - Intronic
1040003623 8:42600009-42600031 GGCAGCTCCGCCTGCAGCCCTGG - Intergenic
1040059699 8:43093648-43093670 GGCCGCACCCCCCGCAGCCCCGG + Intronic
1044880696 8:96719426-96719448 GCAAGCACCGCACGCAGTCCCGG + Intronic
1047124741 8:121948203-121948225 GCCCGGTCCCCCAGCAGTGCCGG + Intergenic
1047381872 8:124372065-124372087 CCGCGCCCCGCCCGCCGTCCTGG - Exonic
1047381965 8:124372409-124372431 GCCCTCTCCGGGCGCTGTCCGGG - Exonic
1048009275 8:130443340-130443362 GCCCGCCCCGCGCCCCGTCCCGG + Intronic
1049003507 8:139840767-139840789 GCCTGCCCCGCCCACAGCCCAGG + Intronic
1049109797 8:140635649-140635671 GCCGCCTCCGCCCGCCGCCCCGG - Intergenic
1049156874 8:141072770-141072792 GCCCCCTCCCCCTGCAGTCCAGG + Intergenic
1049411449 8:142475634-142475656 CCCCGCCCCGCCCGCACTCACGG - Exonic
1049620698 8:143597269-143597291 GCCCGGGCCGCCCGCCCTCCCGG + Intronic
1053027212 9:34740189-34740211 GACAGCTCCACCCGCAGCCCCGG - Intergenic
1057259567 9:93576361-93576383 GCCGCCTCCGCCCGCCGGCCTGG - Intergenic
1059269080 9:113060996-113061018 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1059270216 9:113066445-113066467 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1059271352 9:113071895-113071917 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1059272483 9:113077339-113077361 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1059273618 9:113082781-113082803 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1059274754 9:113088227-113088249 GACGGCTCCCCTCGCAGTCCCGG - Intergenic
1061304467 9:129724375-129724397 TCCCCCTCCTCCCCCAGTCCAGG - Intergenic
1061411129 9:130422345-130422367 GCCAGCTCCGCCCTGAGCCCAGG + Intronic
1061483898 9:130910529-130910551 GGCAGCTCCACCTGCAGTCCCGG + Intronic
1062096218 9:134705362-134705384 GCCCCCTGCGCCTGCAGACCAGG + Intronic
1062428200 9:136515716-136515738 GCCCGCCCCTCCCACGGTCCAGG - Exonic
1186496193 X:10014761-10014783 GCAGGCCGCGCCCGCAGTCCGGG + Intergenic
1186898852 X:14032101-14032123 GCCCCCTCCTCCCCCAGCCCAGG - Intergenic
1188452209 X:30319536-30319558 CCCCGCCCCGCCCGCCTTCCAGG + Intergenic
1196728868 X:118921937-118921959 GGCAGCTCCACCTGCAGTCCCGG - Intergenic
1196741484 X:119029533-119029555 GCAAGCTCCGCACGCAGCCCCGG - Intergenic
1196771565 X:119300088-119300110 GGCCGCTCCACCTGCAGCCCTGG + Intergenic
1200277756 X:154750817-154750839 GTCGGCCTCGCCCGCAGTCCCGG + Intronic