ID: 983907993

View in Genome Browser
Species Human (GRCh38)
Location 4:173205279-173205301
Sequence AAGTCTGCAGGGTTGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983907985_983907993 4 Left 983907985 4:173205252-173205274 CCACGTACTGGGATGGGCCTGGT 0: 2
1: 0
2: 3
3: 23
4: 153
Right 983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG 0: 1
1: 0
2: 7
3: 17
4: 171
983907979_983907993 18 Left 983907979 4:173205238-173205260 CCTTGAGAGGCTGACCACGTACT 0: 1
1: 0
2: 0
3: 9
4: 62
Right 983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG 0: 1
1: 0
2: 7
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983907993 Original CRISPR AAGTCTGCAGGGTTGGTCCT GGG Intronic
900003993 1:32119-32141 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
900023720 1:202639-202661 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
903862550 1:26373532-26373554 ATCTGTGCAGGGCTGGTCCTGGG + Intronic
904340295 1:29829858-29829880 AAGTCTGCCTGGTGCGTCCTGGG + Intergenic
905629125 1:39509126-39509148 AGGGCTGCTGGGTGGGTCCTGGG - Intronic
911215422 1:95187845-95187867 GTGCCTGCAGGGTTGGTTCTTGG + Intronic
911457062 1:98138770-98138792 AAGTATCCAGGATTGGTGCTAGG - Intergenic
912261516 1:108115546-108115568 ATGTCTGCAGGGTTGAAGCTAGG - Intergenic
912420617 1:109540041-109540063 ATGTAGGCAGGGCTGGTCCTTGG - Intronic
913970723 1:143413776-143413798 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914065100 1:144239387-144239409 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG + Intergenic
914888523 1:151602480-151602502 ATTTCTGTAGTGTTGGTCCTGGG + Intergenic
915389471 1:155528508-155528530 AAATCTGCAGGGTGGGTCAGTGG + Intronic
917519671 1:175737595-175737617 AAGTCTGGAACATTGGTCCTAGG - Intronic
922152230 1:223016460-223016482 CAGCCTGCTGGGCTGGTCCTAGG + Intergenic
1063142757 10:3269991-3270013 AAATCTGCGGGGATGGTCATTGG + Intergenic
1063842478 10:10088300-10088322 GTGTCTGCAGGAGTGGTCCTGGG - Intergenic
1063955020 10:11257603-11257625 ACGTCTGCAGAGTTGGCCTTGGG + Intronic
1065000096 10:21330687-21330709 AAGTCTACAGGTTTGGTATTAGG + Intergenic
1065200165 10:23304840-23304862 TAGTCTGTAGAGTTGGTGCTGGG - Intronic
1067703853 10:48592587-48592609 GAGTGTGCAGGGCTAGTCCTTGG + Intronic
1067841199 10:49680682-49680704 AAGTCTGTTGGGGTGGTCCAGGG + Intronic
1068947741 10:62746608-62746630 AGGTGTGCAGGGTAGGTCATAGG - Intergenic
1068964178 10:62895334-62895356 AAGTCTGCAGGGAAGGCCGTGGG - Intronic
1070710264 10:78676333-78676355 AAATCTGCAGGGTTGGGGGTGGG - Intergenic
1070841420 10:79490536-79490558 AAGTCTGCAGAGCTAATCCTGGG + Intergenic
1075997948 10:126893380-126893402 AAGCCTGCAGGGTTGGCTTTGGG - Intergenic
1076545555 10:131243627-131243649 AAGGTTGCAGGGTTGGTTTTAGG - Intronic
1082029126 11:47592215-47592237 AAGTCAGCAGCTTTGTTCCTTGG + Intronic
1084084322 11:66847920-66847942 GAGTCTGGAGGGGTGGTCATGGG + Intergenic
1086912532 11:92489466-92489488 GAGTCTGTTAGGTTGGTCCTTGG + Intronic
1087782899 11:102319776-102319798 CAGTCTGCAGGGTTGCATCTAGG + Intronic
1089174272 11:116537000-116537022 ATATCTGTCGGGTTGGTCCTTGG - Intergenic
1091377417 12:34171-34193 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1092065676 12:5588015-5588037 CTGTCTGCATGGGTGGTCCTGGG + Intronic
1092731640 12:11540352-11540374 AAGGCTGCAGGGTTGGCCCCGGG - Intergenic
1093222111 12:16433864-16433886 ATGTCTGCAGGGTTGATTTTGGG + Intronic
1094012112 12:25820655-25820677 AAGGCTGCAGGGCTGGTGCCTGG - Intergenic
1094500684 12:31018308-31018330 AGGACTGCAGGGTTGGTCCCAGG + Intergenic
1095227745 12:39696588-39696610 ATTTCTTCAGGGTTGGTCCTTGG - Intronic
1098040948 12:66353693-66353715 AAGGCTGCAGGATTGGTGCAGGG - Intronic
1098410022 12:70171408-70171430 AAGTCTGCTGTGTTTTTCCTGGG + Intergenic
1099395675 12:82135482-82135504 GTGTCTGCAGATTTGGTCCTTGG - Intergenic
1100961870 12:99971353-99971375 AATTCTGCAGGGATGTTCTTTGG - Intronic
1101304536 12:103514459-103514481 AAGTGTGCAGGGCAGGGCCTAGG + Intergenic
1102741788 12:115213886-115213908 AAGTCTGCAGATGTGGACCTGGG + Intergenic
1107389220 13:39945674-39945696 AACTCTGAAGGGCTGGTACTGGG - Intergenic
1108903068 13:55436388-55436410 AACTCTGCAGGGCTGGTACAGGG - Intergenic
1109567216 13:64132603-64132625 GATTCTGCAGGATTGGTCCCTGG - Intergenic
1110430113 13:75413618-75413640 ATATCTGCAGGTGTGGTCCTAGG - Intronic
1116340269 14:43714061-43714083 AAGTCTGTAGAGTTGGGCCATGG - Intergenic
1117613160 14:57504715-57504737 AACTATGCAGGGATGGTCCAGGG + Intergenic
1117809825 14:59534482-59534504 AAGTCAGCAGGGCAGGTACTTGG - Intronic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1125902007 15:43357244-43357266 GAGTTTGGAGGGTTGGTTCTGGG + Intergenic
1126079212 15:44942800-44942822 AATAATGCAGGGTTGCTCCTCGG - Intergenic
1129999284 15:80033375-80033397 AAGCCCCCAGGCTTGGTCCTTGG - Intergenic
1131621984 15:94078218-94078240 AAGACTGCTGGGTTGCTCCTGGG + Intergenic
1132449510 15:101958822-101958844 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
1132662613 16:1068346-1068368 AACTCCGCAGGGATGGTCCTCGG + Intergenic
1132710514 16:1264193-1264215 GAGGCTGTAGGGTTGGGCCTCGG - Intergenic
1135425987 16:22336100-22336122 AAACCTGCAGGGGTGGGCCTAGG - Intergenic
1137558775 16:49489872-49489894 AAGGCTGCTGGGTGGGCCCTGGG + Exonic
1138149901 16:54647264-54647286 AAGTCTGTAGGTTTTATCCTTGG - Intergenic
1139193635 16:64893634-64893656 AAGTCTGAAGGGTGGGTGCGGGG + Intergenic
1139490213 16:67281958-67281980 CAGCATGCAGTGTTGGTCCTGGG - Intronic
1140831376 16:78754808-78754830 AGATCTGCACGGTTGGGCCTGGG + Intronic
1142275069 16:89114153-89114175 CAGACTGCAGCGTTGGTCCCGGG + Intronic
1143948279 17:10613346-10613368 ATGTCTGCAAAGTTGGTCATAGG + Intergenic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144955021 17:19014839-19014861 AAGTCCCCACGGTTTGTCCTTGG + Intronic
1148935434 17:51161232-51161254 AAGTCTCCACGGATGGTCCCAGG - Exonic
1150540178 17:66088815-66088837 GAGTGTGCAGGGGTGGGCCTGGG - Intronic
1151249573 17:72823436-72823458 AAGACTGCAGGGTTTGTGCCTGG - Intronic
1152361889 17:79836664-79836686 AACTCCCCAGGGTTGGTCCAAGG - Intronic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1155863024 18:30927865-30927887 AAGCCTGCAGGATTGGGCATTGG - Intergenic
1157761667 18:50269799-50269821 AAGTCTGCAGGGCAGGCACTCGG - Exonic
1160024442 18:75206898-75206920 GGGTCACCAGGGTTGGTCCTGGG - Intronic
1160635745 19:73728-73750 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1161469468 19:4449062-4449084 CAGTCAGCAGGGCTGGTTCTGGG - Intronic
1162587673 19:11570761-11570783 AAGGCTGCAGTGGTGGTCCCTGG - Intronic
1162941319 19:14011288-14011310 AAGTCCCCATGGCTGGTCCTGGG - Intergenic
1163453562 19:17393152-17393174 AAGTCTGAAGGGTTAGTCAGAGG + Intergenic
1165991678 19:39818767-39818789 CAGGCAGCTGGGTTGGTCCTGGG - Intergenic
1166500495 19:43337607-43337629 AAGTCTGCAGGGCAGGCCCTGGG + Intergenic
1166509629 19:43396092-43396114 AAGTCTGCAGGGCAGGCCCTGGG - Intergenic
1166661187 19:44648203-44648225 AAGGCTGCAGCTTTGGTCTTGGG - Intronic
1168413658 19:56155624-56155646 CAGCCTGCAGGGTCCGTCCTGGG + Intronic
926107353 2:10160646-10160668 TGGTCTGCACGGGTGGTCCTGGG - Intronic
927509006 2:23632690-23632712 CACTCTGCAGGGTTATTCCTAGG - Intronic
927720509 2:25379059-25379081 CTGTCTGCAGGCCTGGTCCTTGG - Intronic
928247447 2:29643229-29643251 AAGTTTCCAGGGCTGGTACTGGG + Intronic
929372362 2:41241644-41241666 ATGTCTGTAGGGTTGCCCCTAGG + Intergenic
929600175 2:43199810-43199832 AACTCTGCAGGGTTGGGGTTAGG - Intergenic
930811759 2:55549570-55549592 AATAATGCAGGGTTGCTCCTCGG - Exonic
933371885 2:81425110-81425132 AAGTCTGCAGGGGTTGGCCTGGG + Intergenic
933796131 2:85921278-85921300 ATGTCTGCAGTCTTGGTCCCCGG + Intergenic
934175418 2:89574701-89574723 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
934285734 2:91649064-91649086 CTGTCTGCACAGTTGGTCCTAGG - Intergenic
936565730 2:113581322-113581344 AAGGCTGCAGGGTTGGTCCCAGG - Intergenic
940752815 2:157646363-157646385 AAGGCTTCAGGGTTAGTCTTAGG + Intergenic
945575817 2:211526602-211526624 ATTTCTCCAGGATTGGTCCTTGG - Intronic
946519189 2:220447097-220447119 CAGTCAGCAGTGTTGGTCCTGGG - Intergenic
949067961 2:242004892-242004914 AGGTCTGCAGGGTGGACCCTCGG - Intergenic
1168970118 20:1925204-1925226 AAGTCTGCCGGGAGGCTCCTGGG - Intronic
1169477345 20:5943582-5943604 ACGTGTGCAGGCTTGGTGCTGGG - Exonic
1169567279 20:6868942-6868964 AAGACTGCAGGGGTGGTTGTGGG + Intergenic
1173137344 20:40450486-40450508 AAATCTGCAGTGTTGGAACTGGG - Intergenic
1174286450 20:49477426-49477448 AAGTCTGCTAGGGTGCTCCTGGG + Intronic
1175604368 20:60300009-60300031 AAAGCTGCAGGGCTGGTTCTTGG - Intergenic
1176871074 21:14083819-14083841 TAGTCTGCACGGTGGGGCCTAGG - Intergenic
1181306354 22:21919448-21919470 ACTTCTGCATGGTGGGTCCTTGG + Exonic
1181417835 22:22772951-22772973 ACCTCAGCAGGGTTGGTTCTGGG - Intronic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1183582763 22:38735578-38735600 AAGCCTACAGGGTTGGCCCTGGG + Exonic
1184101142 22:42342339-42342361 GAGTCTCCAGGGTGGGTACTGGG + Intronic
1184324786 22:43774841-43774863 AAGTCAGCAGGGCCTGTCCTTGG + Intronic
1185298120 22:50064072-50064094 AAGGCTGCAGGGTGCATCCTGGG - Exonic
950425227 3:12921424-12921446 AAGCCTGCATGTTTGGTGCTGGG - Intronic
951719382 3:25681523-25681545 AAGTCTCCAGGGCTGGACCGAGG + Intergenic
951815583 3:26750471-26750493 ATTTCTGCAGGGATGATCCTGGG + Intergenic
952247069 3:31606405-31606427 AACTCAGCAGGGAGGGTCCTGGG - Intronic
952341535 3:32451517-32451539 AACTCTGCTGGGTGGGTGCTAGG - Intronic
953674578 3:44990861-44990883 CTGTTTGCAGGGTTGGCCCTTGG - Intronic
955137960 3:56238562-56238584 TAGTCTGCAGGGCTGGCCCAGGG + Intronic
958488350 3:94741124-94741146 AAATCTGCAGGGTAGGGCCGTGG + Intergenic
960862592 3:122167326-122167348 GTGTCTCCAGGATTGGTCCTTGG + Intergenic
963900095 3:150725582-150725604 CAGTCTGCTGGGGTGCTCCTGGG + Intergenic
965503869 3:169489569-169489591 AAATGTGCAGGTTTGTTCCTTGG - Intronic
968395980 4:239063-239085 AAGTCTTCAGGTTTGTTTCTGGG + Intergenic
968606233 4:1537004-1537026 AAGGCTGCAGGGATGGGTCTGGG - Intergenic
969471648 4:7392651-7392673 AGGGCTGCTGGGCTGGTCCTGGG + Intronic
969715412 4:8865921-8865943 AAGCCTGCAGGGTGGGGACTGGG + Intronic
972674046 4:41242199-41242221 AAGGCTGTAGGGCTGGGCCTTGG + Intergenic
973099901 4:46253399-46253421 AAATATGCAGGGTTGATACTTGG - Intronic
981558452 4:146022031-146022053 ATTTCTCCAGGATTGGTCCTTGG + Intergenic
982200664 4:152957036-152957058 AAGACTCCAGGGTTGGCCCTGGG - Intronic
983907993 4:173205279-173205301 AAGTCTGCAGGGTTGGTCCTGGG + Intronic
986300098 5:6471579-6471601 AAGACTGCAGCTTTGATCCTGGG - Intronic
986372935 5:7098734-7098756 AAGTCTGCAGAACTGGTCCTGGG - Intergenic
990498073 5:56368498-56368520 CAGTCTGCAGTGTTAGTTCTTGG + Intergenic
991328906 5:65470039-65470061 AAGACTACAGGGTTTATCCTGGG - Intronic
994326195 5:98448428-98448450 AAGTCTAGAGGCTTAGTCCTGGG - Intergenic
997264347 5:132486439-132486461 CAGGCTGCAGGGTTGGTCGGAGG - Intronic
998371254 5:141663175-141663197 CAGTAAGCAGGGTGGGTCCTAGG - Intronic
1001704083 5:173729255-173729277 AACTCTCAAGGGTTGGACCTGGG - Intergenic
1002416650 5:179124329-179124351 AGGGCTTCAGGGGTGGTCCTAGG - Intronic
1002421430 5:179151297-179151319 AAGTCTTCAAGGATGGGCCTGGG + Intronic
1002714475 5:181217862-181217884 TAGTCTGCAGGTGTGGCCCTGGG - Intergenic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1007981785 6:46166752-46166774 CACTTTGCAGGGTTGGTCTTAGG - Intronic
1009687652 6:66985477-66985499 ATGTCTCCAGGATTGGTCCTTGG + Intergenic
1011543809 6:88463175-88463197 CAGTCGGCAGGGTTGGTCAGGGG + Intergenic
1012523158 6:100144924-100144946 AACTTTGCAGGGTTAGTTCTAGG - Intergenic
1012714018 6:102646399-102646421 AGGTCTTCAGTGTTGTTCCTGGG - Intergenic
1016265049 6:142222723-142222745 AAGACTGCAGGCTTGTTCATTGG + Exonic
1018698463 6:166408602-166408624 CAGTCTGCACTGTTGGTCCTTGG - Intergenic
1019641378 7:2105588-2105610 AAGGCTGCATGGCTGGTCCCAGG - Intronic
1020137764 7:5596139-5596161 GAGTCTGCAGGGGTGGGCGTGGG + Intronic
1021389736 7:20077020-20077042 AAGTCTGCAGGTTTAGTCTCTGG + Intergenic
1021995935 7:26178495-26178517 TTGGCTGTAGGGTTGGTCCTCGG - Intronic
1029264410 7:99326832-99326854 AAGTCTGGAGGGTTGGTGTTTGG - Intronic
1032371789 7:131362466-131362488 AAGTCTGCATAGTTTGTACTAGG + Intronic
1033584772 7:142766114-142766136 AAGTCTGCAGGGCGTGTGCTCGG + Intergenic
1034080815 7:148276212-148276234 AATTCTGCAGGGTTTCTCCTGGG - Intronic
1035272359 7:157727996-157728018 ACGTCTGCAGGGTGGGAGCTGGG - Intronic
1039267503 8:35841759-35841781 GAGTCTTCAGGGGTGGGCCTGGG - Intergenic
1042203735 8:66307222-66307244 AAGTCTGCTGGGGTTGTCCAAGG + Intergenic
1045028950 8:98117138-98117160 AAGCCAGCAGGGCTGGTGCTGGG - Exonic
1045499349 8:102732983-102733005 GTGTCAGCAGGGTTGGTTCTTGG - Intergenic
1046634896 8:116663338-116663360 AACTTTGCAGAGTTGGTCCAGGG + Intronic
1047160309 8:122370786-122370808 AAGGGTGCAGTGTTGTTCCTGGG + Intergenic
1047439887 8:124868209-124868231 AAGCCTGCTGGGATGGTGCTTGG - Intergenic
1049311620 8:141936670-141936692 AGTTCTGCAAGCTTGGTCCTTGG + Intergenic
1049498376 8:142947361-142947383 AATTCTCCAGGGTTGTTCCTGGG - Intergenic
1049886687 9:31901-31923 AAGGCTGCAGGGTTGGTCCCAGG + Intergenic
1051786034 9:20744638-20744660 ATGACTGAAGGGTTGGTCTTAGG + Intronic
1052885066 9:33638427-33638449 CAGGCTGCAGGGTGGGTTCTTGG - Intergenic
1053173976 9:35909388-35909410 AGGGCTGCAGTGTGGGTCCTGGG + Intergenic
1053652081 9:40178824-40178846 CTGCCGGCAGGGTTGGTCCTTGG + Intergenic
1054532505 9:66197382-66197404 CTGCCAGCAGGGTTGGTCCTTGG - Intergenic
1056201832 9:84284416-84284438 AAATCTGCAGGCTTGTTCTTTGG + Intronic
1059314609 9:113413453-113413475 AATGCTGCAGGGTTGGCCTTTGG + Exonic
1060543658 9:124448199-124448221 CAGCCTGCAGGCTTTGTCCTTGG + Intergenic
1186710944 X:12195721-12195743 CGGCTTGCAGGGTTGGTCCTTGG - Intronic
1186987524 X:15032939-15032961 AAGTCTCCTGGGAGGGTCCTAGG + Intergenic
1188774254 X:34193560-34193582 ATTTCTCCAGGATTGGTCCTTGG + Intergenic
1189613600 X:42763226-42763248 AGGTCTGCAGTCCTGGTCCTCGG + Intergenic
1189976199 X:46463121-46463143 CAGCCTGCAGGGGTGGGCCTAGG + Intronic
1189982867 X:46528500-46528522 CAGCCTGCAGGGGTGGGCCTAGG - Intronic
1194892403 X:99397163-99397185 CAGTCTCCAGGATTGGTCCCTGG + Intergenic
1198206060 X:134466078-134466100 AAGTCGGGAGGGTTGGGCCCAGG + Intronic
1198749501 X:139924509-139924531 CTGTTTGCAAGGTTGGTCCTTGG + Intronic
1199786528 X:151111590-151111612 AACTCTGGAGGGCTGGTACTGGG + Intergenic