ID: 983914327

View in Genome Browser
Species Human (GRCh38)
Location 4:173275348-173275370
Sequence TCAGTTCCCCACTCAGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983914327_983914329 9 Left 983914327 4:173275348-173275370 CCGAGCTCTGAGTGGGGAACTGA 0: 1
1: 0
2: 1
3: 14
4: 194
Right 983914329 4:173275380-173275402 GGTGTTGTCATGATAACACCTGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983914327 Original CRISPR TCAGTTCCCCACTCAGAGCT CGG (reversed) Intronic
900838446 1:5026023-5026045 AACGTTCCCCACTCTGAGCTCGG + Intergenic
902173203 1:14629730-14629752 TCAGTGCCTGACTCAGAGGTGGG - Intronic
902205415 1:14864811-14864833 TCACTTCCCCTCTCAGACCTTGG + Intronic
903030689 1:20462278-20462300 TTAGTTCCCCACCCAAAGCTGGG - Intergenic
903474106 1:23607590-23607612 CCCGTTCCCCAGTCTGAGCTGGG + Intronic
903925059 1:26826329-26826351 TCAGTTCGACCCTCAGAGATGGG + Intergenic
904259504 1:29280244-29280266 TCAGTCTCCCACGCAGGGCTTGG + Intronic
905774269 1:40658483-40658505 TCAGTGCCCCGCTCAGAGAAGGG - Intronic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
906300592 1:44678590-44678612 TCAGTTCTCCATTCAGAGATAGG - Intronic
907484261 1:54766212-54766234 CCAGCTCCTCACACAGAGCTTGG + Intergenic
909878252 1:80838921-80838943 TCTGTTCCCCAAACAGAGCTAGG - Intergenic
912115134 1:106396705-106396727 TCACTTCACCACTCAGGCCTTGG + Intergenic
913990663 1:143608792-143608814 TCAGTTCCTCACTCTGACCAGGG + Intergenic
915676901 1:157540346-157540368 TCAGCTCCTCACTCTGACCTGGG + Intronic
922759998 1:228122644-228122666 TCTGTACCCCACTCAGTGGTGGG - Intergenic
924629393 1:245722788-245722810 TCAGTTCTCCACTGAGAAGTCGG - Intergenic
1062959373 10:1561243-1561265 CCAATTACACACTCAGAGCTGGG - Intronic
1064996024 10:21297287-21297309 GCAGTTCCAGACGCAGAGCTTGG - Intergenic
1066566725 10:36729026-36729048 TCTGTTCCCCTCTCACAACTGGG - Intergenic
1067155619 10:43779144-43779166 TCAGCTCCCCAGTCAGATCAAGG + Intergenic
1067237360 10:44462266-44462288 CCAGTTCCCCGCTTAGGGCTGGG - Intergenic
1070514704 10:77193801-77193823 TCAGCTCTCCATTCAGACCTGGG - Intronic
1071525024 10:86353612-86353634 TCAGGTCCCTTCACAGAGCTGGG + Intronic
1072451447 10:95542281-95542303 TCTGTTCCTTACTCATAGCTGGG + Intronic
1072623799 10:97098306-97098328 GCTGCTCCCAACTCAGAGCTGGG + Intronic
1073244780 10:102082055-102082077 TCAGCTGCCCACTCAGGCCTGGG + Intergenic
1073488704 10:103838411-103838433 TCACTTACCCCCTCAGTGCTTGG - Intronic
1075671736 10:124267829-124267851 TCAGTATCCGACTCAGGGCTAGG + Intergenic
1075978132 10:126714653-126714675 ACAGACCCCCACTCAAAGCTTGG + Intergenic
1076484886 10:130809484-130809506 ACAGGTCCCCACACAGAGCAGGG + Intergenic
1076536477 10:131181147-131181169 CCAGTTCTCCAGCCAGAGCTGGG + Intronic
1079367041 11:19818381-19818403 TAATTTACCCACTCTGAGCTGGG + Intronic
1081832504 11:46125532-46125554 TCAGCTCCCCACTAGTAGCTTGG - Intergenic
1081964691 11:47162337-47162359 CCAGTGGCCCACTCAGACCTGGG + Intronic
1083720727 11:64602277-64602299 CCAGCTCCCCACACAGCGCTGGG + Exonic
1085179568 11:74522093-74522115 TCACTTCCCTACACAGAGCCAGG - Intronic
1085507517 11:77068699-77068721 TCTGCTCCCCACCCAGGGCTAGG + Intronic
1089636607 11:119817940-119817962 TTAATTTGCCACTCAGAGCTTGG + Intergenic
1089661013 11:119985263-119985285 TCAGTTTCCCACTCAGAGCCAGG - Intergenic
1090972555 11:131655778-131655800 TCATTGCCTCACACAGAGCTTGG - Intronic
1093792014 12:23263204-23263226 ATAGTTCCCAAATCAGAGCTGGG - Intergenic
1094168761 12:27469143-27469165 TCTGTTCACCTTTCAGAGCTTGG + Intronic
1096975324 12:55696488-55696510 TCAGTGCCCCAGCCAGACCTAGG + Intronic
1098964924 12:76777795-76777817 TCAGTTCCCCAATCCCTGCTAGG - Intronic
1100742921 12:97615066-97615088 TCTGTGCCCAACTGAGAGCTTGG - Intergenic
1102046028 12:109830934-109830956 GCCGCTCTCCACTCAGAGCTTGG + Intronic
1104492670 12:129208502-129208524 TCAAATCCCCACTAAGTGCTAGG - Intronic
1104634281 12:130427906-130427928 TCAGTTCCTGGCACAGAGCTGGG + Intronic
1108249906 13:48553965-48553987 TCATTTCCCCACTTAGAACCAGG - Intergenic
1108291093 13:48961808-48961830 TCTGTTCACAGCTCAGAGCTGGG + Intergenic
1110569782 13:76991545-76991567 TCATTTCCCCACTAAGCACTTGG + Exonic
1115429584 14:33300860-33300882 TCAGGTCCCCAATCTGAGCCAGG - Intronic
1118309609 14:64682678-64682700 TCAGTTTCCTCCTCAGGGCTGGG - Intergenic
1118494484 14:66294779-66294801 TCAGTGCCCTACACAGTGCTTGG + Intergenic
1118854846 14:69612483-69612505 TCAGATCCACACTCATAGCTGGG - Intronic
1121331550 14:93052779-93052801 TCAGTCCCTCACTCAGAACTGGG + Intronic
1121732900 14:96198586-96198608 CCAGTTCCTCACCCAGGGCTTGG - Intergenic
1122823913 14:104360448-104360470 TCTGTTCCCCATTCACAGGTGGG + Intergenic
1124610846 15:31207288-31207310 TCAGAAACCCACCCAGAGCTGGG - Intergenic
1125791011 15:42365648-42365670 CCCGTTCCCAGCTCAGAGCTGGG + Intronic
1127536880 15:59898428-59898450 TCATTTCTCCTCTCTGAGCTTGG - Intergenic
1127777665 15:62279514-62279536 ACATTTCTCCACTGAGAGCTAGG + Intergenic
1128107676 15:65056412-65056434 TCTATTCCCCACCCAGGGCTGGG + Intronic
1128905212 15:71461454-71461476 CCAGTTGCCATCTCAGAGCTGGG + Intronic
1129168111 15:73790762-73790784 TAAGTGCCACATTCAGAGCTAGG - Intergenic
1129846563 15:78770544-78770566 TCAGTCCTCCTCTCACAGCTCGG - Intronic
1131533364 15:93213416-93213438 TCAGTTGCCCACACAGACATTGG - Intergenic
1132515592 16:364319-364341 TCAGTTCCCCACACACATGTTGG + Intergenic
1133464208 16:6014561-6014583 TCTGTTCCCCCCTCAGTCCTTGG - Intergenic
1135268828 16:21051632-21051654 TCCGTTCACCCCTCAGATCTAGG + Intronic
1136072388 16:27795661-27795683 TCAAGGCCCCACTCAGAGCGTGG + Intronic
1137768011 16:50992690-50992712 CCTGTTCCACACTCAGAGCCAGG - Intergenic
1139309013 16:66012602-66012624 TCACTTCCCCACTCTTGGCTGGG - Intergenic
1139360948 16:66399673-66399695 GCAGATCCCCACTCTGAGATGGG - Intronic
1143540222 17:7563988-7564010 GCAGTTTCCCAGGCAGAGCTAGG + Intronic
1143825731 17:9605459-9605481 TCAGCTCCCCACAAAGTGCTGGG - Intronic
1143911227 17:10251498-10251520 TCAGAACCCCACTCCGAGCTTGG + Intergenic
1144521102 17:15952772-15952794 TCAGTTCCCCAATCCGAGGAAGG - Intronic
1145278385 17:21450531-21450553 TCAGTTACCCCATCACAGCTGGG - Intergenic
1145770808 17:27491758-27491780 CCACTTCCCCACACAGACCTGGG - Intronic
1146488745 17:33264714-33264736 TCAGTTCCCTTCTCTGGGCTTGG + Intronic
1149046286 17:52249555-52249577 TCACTCCTCCACCCAGAGCTAGG + Intergenic
1149513665 17:57263575-57263597 TCATTTGATCACTCAGAGCTTGG + Intronic
1149558674 17:57592827-57592849 CCAGTTTCCCACTCTGAGATGGG - Intronic
1150828625 17:68498652-68498674 GCAGCTCCCCACTCAGTTCTTGG + Intergenic
1151022205 17:70630524-70630546 TCAATGCACCACTCTGAGCTAGG - Intergenic
1152857808 17:82676094-82676116 TCGGTTCCCCATTCATAGCCAGG - Intronic
1153151652 18:2102006-2102028 TATATTCCCCACACAGAGCTAGG + Intergenic
1156751225 18:40458121-40458143 TCATTTCCCCACTAAGAGAAAGG - Intergenic
1157704076 18:49787332-49787354 TCAGTGCCCCACTGATAGCAGGG + Exonic
1158330061 18:56352219-56352241 TCAGATCCCCATTCAGAGACTGG + Intergenic
1160488871 18:79320217-79320239 TCAGTTCCCCACACAGGTCCAGG - Intronic
1160965439 19:1745215-1745237 TCTATTCCCCTCTGAGAGCTGGG + Intergenic
1161918805 19:7250846-7250868 TGAGCTCCAGACTCAGAGCTAGG - Intronic
1162052281 19:8041774-8041796 CCAGTTGCCCACTCAGTCCTGGG - Intronic
1165229045 19:34374978-34375000 TCAGTTTCCCAGTAAGTGCTGGG + Intronic
1165334679 19:35161103-35161125 TCAGTTCCCCTCGGAGGGCTGGG + Intronic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
927970727 2:27304925-27304947 ACAGGTCAGCACTCAGAGCTGGG - Intronic
928268469 2:29832752-29832774 GCAGTGCCTCACTCAGAGCCTGG - Intronic
933342737 2:81043253-81043275 TAAGATCTCCACTGAGAGCTTGG + Intergenic
934625555 2:95847439-95847461 TCAGTTACCCACCCAGTGCAGGG + Intronic
934808017 2:97253879-97253901 TCAGTTACCCACCCAGTGCAGGG - Intronic
934818067 2:97347724-97347746 TCAGTTTCCTACTGAGAGTTAGG + Intergenic
934819629 2:97360761-97360783 TCAGTTTCCTACTGAGAGTTAGG - Intergenic
934829493 2:97503308-97503330 TCAGTTACCCACCCAGTGCAGGG + Intronic
934935825 2:98464587-98464609 TCAGTTCCCATGTCAGAACTCGG + Intronic
935621111 2:105130384-105130406 TCTGGGCCCCACTCAAAGCTGGG + Intergenic
936286403 2:111184660-111184682 TCACTTGGCCACTGAGAGCTGGG - Intergenic
936655718 2:114484368-114484390 TGAATTCCCCATTCAGAACTCGG - Intronic
936678020 2:114738258-114738280 TCAGTACTCAACTCAGTGCTTGG + Intronic
937333219 2:121044936-121044958 TCAGTGGCACACTCAGGGCTGGG - Intergenic
943993027 2:194721523-194721545 TAAGTGCCCCACTCAGCCCTTGG - Intergenic
945428936 2:209741616-209741638 TAATTTCCCCACTCATAGCTTGG + Intergenic
946111132 2:217418417-217418439 TCACTTTCCCACTCACAGTTTGG - Intronic
946164371 2:217854941-217854963 CCACTTACCCACTCAGAGCCCGG + Intronic
946409222 2:219508153-219508175 GCAGGTCCCCACTCTGGGCTGGG + Intergenic
947469663 2:230389325-230389347 TCAGTTCCCCACCCCCTGCTAGG + Intronic
948483951 2:238268212-238268234 ACAGTTCCCAACTTAGAGCGTGG - Intronic
1168893394 20:1308407-1308429 GCAGCTCCCCACTCAGCCCTGGG + Exonic
1172149649 20:32780777-32780799 CCCTCTCCCCACTCAGAGCTGGG + Intronic
1172333051 20:34089327-34089349 TCAGTTTCTCAGTCAGAGCCCGG + Exonic
1173469210 20:43309553-43309575 TCAGTTCAGCTCTCAGAGCTTGG - Intergenic
1173851395 20:46220626-46220648 TCCAGCCCCCACTCAGAGCTGGG - Intronic
1175989955 20:62783642-62783664 CCTGTTCCCCACTCAGACCCAGG - Intergenic
1177201961 21:17967469-17967491 TCAGTTTCTCCCTAAGAGCTTGG + Intronic
1179272611 21:39863280-39863302 TCAGGTGCCGACTCAGTGCTGGG + Intergenic
1179567032 21:42255637-42255659 TCTCTTCCCCACTTAGGGCTGGG + Intronic
1180169549 21:46050750-46050772 GCAGTCCCCCATCCAGAGCTGGG + Intergenic
1180594681 22:16965380-16965402 TCAGTCCCCCGCACACAGCTGGG - Intronic
1180902646 22:19385826-19385848 TCCCTTCTCCACTCAGAGCCAGG - Intronic
1183326360 22:37196804-37196826 CCATTCCCCCACTCACAGCTGGG + Intronic
1184302038 22:43567081-43567103 TCCTTCCCCCACTCAGAGTTAGG + Intronic
1184469847 22:44690235-44690257 TCACCTGCCCACACAGAGCTGGG - Intronic
1185404781 22:50641603-50641625 CCAGCTCCCCACACACAGCTGGG - Intergenic
949920068 3:8993483-8993505 TCACCTCCCCACCCAGGGCTTGG + Intronic
950126990 3:10515725-10515747 TCAGTTCCCCCTTCTGAGCCTGG + Intronic
950609956 3:14120112-14120134 CCAGTTCCCCACTCTGACCAAGG - Intronic
951772436 3:26273488-26273510 TCAGTACCCCAAACAGAGTTTGG - Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954620459 3:51992485-51992507 TCAATTGCCCAACCAGAGCTGGG - Intergenic
955097931 3:55818217-55818239 CAAGCTCCACACTCAGAGCTGGG + Intronic
955191872 3:56769321-56769343 TGAGGTCCCCTTTCAGAGCTGGG + Intronic
955480011 3:59380275-59380297 TCATTTCTCCACTCAGTGTTAGG - Intergenic
960556330 3:119034703-119034725 GCTGTTCCCCGCGCAGAGCTGGG + Exonic
960712743 3:120547141-120547163 TCACTTTCTCTCTCAGAGCTGGG + Intergenic
961402947 3:126659953-126659975 TCAGTGCTTCACACAGAGCTGGG + Intergenic
961465787 3:127080739-127080761 TCAGCTCCTCCCTCAAAGCTGGG - Intergenic
961825795 3:129598440-129598462 AGAGCTCCCCACCCAGAGCTTGG + Intronic
962105375 3:132383538-132383560 TCAGTTCCACAGCCACAGCTTGG + Intergenic
962841072 3:139233091-139233113 TCAGTTTCCCACTTAGAACATGG + Intronic
964834630 3:160924206-160924228 TCAGTTGCTCCCACAGAGCTTGG + Intronic
965467438 3:169047933-169047955 TCACTTCTGCACTCAGAGGTAGG + Intergenic
966640638 3:182185963-182185985 TGAGTTGCCCACTAAGAGCTGGG - Intergenic
968915959 4:3497201-3497223 ACAGGTCCACACTCAGGGCTTGG - Intronic
968974149 4:3812292-3812314 TCTGAGCCCCACTCAGAGGTGGG + Intergenic
977160932 4:93634070-93634092 TCACTTCTGCTCTCAGAGCTTGG - Intronic
978871899 4:113588981-113589003 CCAGCTCTCCTCTCAGAGCTTGG - Intronic
982594030 4:157354737-157354759 TCTTTTCCCCTCTCAGTGCTGGG - Intronic
983561077 4:169102101-169102123 TCAGTTCATCACTCTGACCTGGG + Intronic
983914327 4:173275348-173275370 TCAGTTCCCCACTCAGAGCTCGG - Intronic
985672604 5:1214088-1214110 TCAGTTTCCCTCTCAGTCCTGGG + Intronic
987213312 5:15706898-15706920 TCAGTTCCCCAGTCTTACCTGGG - Intronic
990722470 5:58712305-58712327 TCAGTACCCCACACAATGCTAGG + Intronic
992748274 5:79839739-79839761 TCAGGTCCCCACACAAAGCCAGG - Intergenic
995222728 5:109669116-109669138 TCAGTTCCCTTCTCAGTTCTTGG - Intergenic
997599305 5:135128317-135128339 TCAGTTCCCCACACTGTGCTTGG - Intronic
998185407 5:139975443-139975465 TCAGTACCCCTCCCTGAGCTTGG + Intronic
998569398 5:143243979-143244001 TCTGTTCCCCACGCAGAGACAGG + Intergenic
999562354 5:152818374-152818396 TCAGTTCCCAGCACAGTGCTTGG + Intergenic
1001265993 5:170275022-170275044 TCAGGTGCTCACTCAGAGGTGGG + Intronic
1002172740 5:177384521-177384543 GCTGTTTCCTACTCAGAGCTGGG - Intronic
1006391826 6:33763145-33763167 TGAGGTCCTCACTCAGAGCCTGG + Intergenic
1007415960 6:41691350-41691372 TCTCTTCCCCTCTCAGGGCTCGG - Intronic
1007697004 6:43740443-43740465 TCAGGATCCCACTCATAGCTGGG - Intergenic
1007707283 6:43798614-43798636 TCAGTTCCCTCCTCTGATCTGGG - Intergenic
1007983097 6:46179326-46179348 TCAGTTCCCATCACAGGGCTAGG - Intergenic
1008163053 6:48102288-48102310 TAAGTTCCTCACTCACATCTAGG - Intergenic
1011879496 6:92007046-92007068 GCAGTTCTCCAGTCAGAGCAGGG - Intergenic
1012903927 6:105042090-105042112 TCATTTGCCCACTCTGTGCTGGG + Intronic
1019940131 7:4282986-4283008 TGAATTCCCCACACAGGGCTAGG + Intergenic
1021459748 7:20872783-20872805 TCAGTTCGCCACCCATAGCTGGG - Intergenic
1021982103 7:26065070-26065092 GCAGATCCCGACTCAGAGATTGG - Intergenic
1022041708 7:26587898-26587920 TCAGTTCCCCACTCTGGTCAGGG - Intergenic
1030918487 7:115348374-115348396 TCATTTCGCCACTCAGATCCAGG + Intergenic
1032465856 7:132144497-132144519 TCTCTTCACCACACAGAGCTTGG + Intronic
1032728468 7:134614271-134614293 TCTCTTCCCCACCCAGATCTTGG + Intergenic
1034497247 7:151430399-151430421 ACAATTCCCCACCAAGAGCTGGG - Intronic
1035766214 8:2107691-2107713 TCAGTTCACCACTCACAGGCAGG + Intronic
1036343884 8:7942423-7942445 TCAGTTCACATCTCAGTGCTTGG - Intronic
1037598202 8:20372312-20372334 GCAGTTCCACACTCTGAGCAGGG + Intergenic
1037967443 8:23145464-23145486 TCAGTCCCTCTCTCAGGGCTGGG - Intronic
1038875013 8:31538935-31538957 TCATTTCCCCTTGCAGAGCTAGG + Intergenic
1040468093 8:47713889-47713911 TGAGTTCCCCACTAAGACGTGGG - Intronic
1043100253 8:76035996-76036018 TCAGTTCCCCACTATGACCATGG + Intergenic
1048793920 8:138130805-138130827 TGAGCTCCCGAGTCAGAGCTGGG - Exonic
1049577746 8:143397455-143397477 CCAGTGTCCCACTCAGAGCTGGG + Intergenic
1052901810 9:33799896-33799918 CCAGCTCCCCACTCTGACCTGGG + Intergenic
1055170133 9:73247307-73247329 TAAGTTCTCCAATCAGAACTTGG + Intergenic
1058463750 9:105208142-105208164 TCAGTTCCCCCCTTAGCTCTGGG + Intergenic
1061101366 9:128494961-128494983 TCAGCTCCACACCCACAGCTGGG + Intronic
1062452165 9:136620367-136620389 TCAGCTCCCCTGACAGAGCTCGG + Intergenic
1186584642 X:10859702-10859724 TCTCTTGCCCACTCAGACCTAGG + Intergenic
1187618833 X:21027950-21027972 TCAGTTCCTCTTTCAGAGATAGG + Intergenic
1189155168 X:38749692-38749714 CCAATTCCTCAGTCAGAGCTTGG + Intergenic
1190054151 X:47172158-47172180 TCACATTCCCACTCAGGGCTTGG - Intronic
1190114294 X:47616156-47616178 TCTGTTCCCCACACTGAGCCTGG + Intronic
1190257748 X:48776256-48776278 TCAGTGCCCCACTGATAGCAAGG + Intergenic
1191780270 X:64856913-64856935 TCAGCGCCTCACACAGAGCTTGG + Intergenic