ID: 983916246

View in Genome Browser
Species Human (GRCh38)
Location 4:173294911-173294933
Sequence CTTTCAACACTGATTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983916241_983916246 18 Left 983916241 4:173294870-173294892 CCAACTTGGTGGGAACCATATTC 0: 1
1: 0
2: 1
3: 5
4: 80
Right 983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG 0: 1
1: 0
2: 3
3: 10
4: 146
983916243_983916246 3 Left 983916243 4:173294885-173294907 CCATATTCATCATACCAAGGTTA 0: 1
1: 0
2: 1
3: 8
4: 113
Right 983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG 0: 1
1: 0
2: 3
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983916246 Original CRISPR CTTTCAACACTGATTGTGGT TGG Intronic
901936921 1:12633224-12633246 CTTTCAGCTCTAATTGGGGTAGG + Intergenic
906084649 1:43120964-43120986 GTTTCAACACTGTTTTTGTTGGG + Intergenic
908247768 1:62241586-62241608 CTTTCAACAATGTTTGTTGAGGG - Intronic
908581723 1:65524355-65524377 CTTTCAGCACTATCTGTGGTAGG - Intronic
908673173 1:66571451-66571473 CTTAGAAAACTGATTGTGGTTGG + Intronic
909772917 1:79447123-79447145 CTATCAACATTGATTATGTTAGG + Intergenic
912225145 1:107724811-107724833 GTTGCAACACTGGATGTGGTGGG + Intronic
915810115 1:158900181-158900203 CTTTCCAGACTGATTTTGTTAGG + Intergenic
917253293 1:173086614-173086636 CTTTCAACACAAATTTTGGAGGG + Intergenic
917514985 1:175699717-175699739 CTTACAACAGAGATTGTGGAAGG + Intronic
921346086 1:214187010-214187032 CTTTTAAGAATGATTGTGTTTGG + Intergenic
923057342 1:230436947-230436969 ATTTCAACACTGATTTATGTTGG - Intergenic
1063119281 10:3093247-3093269 CTTTCAACACTGTTGGGGGAAGG - Intronic
1064558674 10:16573850-16573872 CTTTCAACCCTGATTTTCTTGGG + Intergenic
1065992237 10:31023279-31023301 CTATCAAGACTAATTGTGGCAGG + Intronic
1068140257 10:52996665-52996687 CTTTAAACACTGCTTTTGGAAGG - Intergenic
1071809230 10:89160619-89160641 GCTTCAACACTGAGGGTGGTTGG + Intergenic
1072171737 10:92869721-92869743 TTTTCACCACTGATTCTGTTGGG + Intronic
1072607410 10:96996382-96996404 CTTTCAACTCTGCTTGAAGTGGG + Intergenic
1072927457 10:99628840-99628862 TTTTCAACAATGATTGTGGTGGG - Intergenic
1076102821 10:127796857-127796879 CTTTAAACACTGTGTGTGGTGGG - Intergenic
1076622037 10:131795752-131795774 ATTTCAACATTCATTTTGGTGGG + Intergenic
1077653845 11:3999569-3999591 CATTCTAGAGTGATTGTGGTGGG + Intronic
1077936348 11:6791227-6791249 CTTTCAACAAAGATTTTGGTTGG - Intergenic
1080364874 11:31561992-31562014 CTTTCAACACTGCCTATGGATGG - Intronic
1080395021 11:31882225-31882247 CTTTGAATACTGATTGTGTTTGG - Intronic
1085157952 11:74313251-74313273 ATGTCACCACTGACTGTGGTTGG + Intergenic
1086003034 11:82002931-82002953 CTTTGAACTCTGCTTGTGGTAGG - Intergenic
1087151913 11:94867194-94867216 CTTCAAACACAGATTCTGGTTGG - Intronic
1087379294 11:97384503-97384525 CTTTCCACACTAATTGTGGTTGG + Intergenic
1090732474 11:129583591-129583613 CTCTCACAACTGATTTTGGTCGG - Intergenic
1097440266 12:59599268-59599290 CCTTCAACACTGAATCTGGCAGG + Intronic
1102227551 12:111239735-111239757 CTTTCTACAATGAGTGGGGTGGG + Intronic
1103002011 12:117391998-117392020 CTTCCAAAACTGGTTGTGTTTGG - Intronic
1104522383 12:129487568-129487590 CTTTCAACACTGACTTTGGAGGG - Intronic
1105873854 13:24536489-24536511 CCTTAAATACTGCTTGTGGTAGG + Intergenic
1108908281 13:55507397-55507419 CTTTCAACACTGTTTGATGGAGG - Intergenic
1110287036 13:73761804-73761826 CTTTCTCCAGTGACTGTGGTAGG - Intronic
1112348076 13:98609445-98609467 CTTTCAACACAGAATGCGGCCGG + Intergenic
1114618147 14:24079386-24079408 CCTTCAACAATGAGTGTGGAAGG + Intergenic
1116549367 14:46216046-46216068 CTTATAACACTGATTGTCCTGGG - Intergenic
1119181250 14:72606678-72606700 ATTTCAACACGGAATTTGGTGGG - Intergenic
1121893795 14:97625484-97625506 CTACCAATACTGATTTTGGTGGG - Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1122431695 14:101654002-101654024 CTTCTAAGACTGATTGTGGGAGG + Intergenic
1127578901 15:60318826-60318848 CTTTCAACTCTAATGGTGGGAGG - Intergenic
1128499385 15:68217136-68217158 CATTAAACACTTATTGTGTTAGG + Intronic
1130153313 15:81328845-81328867 CTTTCAACCCTGCGTGTGTTTGG + Intergenic
1130174084 15:81549263-81549285 CTTTCAACACTGCTAGTGAGAGG + Intergenic
1131999487 15:98164398-98164420 CTCTCAACACTGGTTGAGGGCGG - Intergenic
1132212917 15:100038128-100038150 CTTTCTCCACTGATTGCTGTTGG + Intronic
1132250770 15:100334066-100334088 CTTTCAACTCTCTTTGTTGTGGG + Intronic
1133172322 16:3988685-3988707 CTTTCAGGACAGGTTGTGGTGGG + Intronic
1137048583 16:35689953-35689975 ATTTTTACACTGCTTGTGGTCGG + Intergenic
1138051290 16:53781470-53781492 CTTCCACCACTGAATGTGGTGGG - Intronic
1139252766 16:65511897-65511919 ATTTCAACCATGGTTGTGGTTGG - Intergenic
1140890975 16:79285017-79285039 TTTTCAGCACTGAGTTTGGTTGG - Intergenic
1142258227 16:89026086-89026108 CTTTCAACACTGCCCTTGGTGGG - Intergenic
1145838197 17:27970730-27970752 CTTGCCACACTGATTGGGCTGGG + Intergenic
1146253956 17:31378110-31378132 CTTTCTCCACTGATTGGGGGAGG - Intronic
1149416164 17:56462082-56462104 CTTTCATCACTTTTTTTGGTAGG + Intronic
1150191900 17:63251139-63251161 CTTCCTTCACTGATTGTAGTAGG - Intronic
1153500009 18:5739153-5739175 CCTTCAAGGCCGATTGTGGTTGG + Intergenic
1153931731 18:9885261-9885283 CTTTCAACACTTATATTGTTGGG + Intergenic
1154004846 18:10518495-10518517 CTTTCATCTCTGATTATGTTGGG + Intergenic
1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG + Intronic
1156206109 18:34887600-34887622 CTTTCATTCCTGATTGTCGTAGG + Intronic
1156735629 18:40255193-40255215 CTTTCACAGCTGAGTGTGGTTGG + Intergenic
1158305919 18:56105357-56105379 CTTTCAACACTGGTTGCATTGGG - Intergenic
1160057388 18:75496335-75496357 CTTTCAACCATGACTGTGGGAGG + Intergenic
1161729538 19:5950916-5950938 TTTGCAAGACTGATTGTGTTTGG - Intronic
1165465328 19:35971272-35971294 GTTTTAGCACTGACTGTGGTTGG - Intergenic
1167616098 19:50534700-50534722 CTTTCCACTTTGGTTGTGGTAGG + Intronic
1168630443 19:57951880-57951902 CTTTCAACTCTGTTTTAGGTGGG + Intergenic
926236697 2:11051135-11051157 CTTTCAACAGGGATTTTTGTGGG - Intergenic
927301124 2:21516362-21516384 ATTTCTAGAGTGATTGTGGTAGG - Intergenic
928241016 2:29586639-29586661 CTTTCAACACTCATTTAGGCTGG + Intronic
928722397 2:34134726-34134748 CTTTCAACTCTGATTTCGTTGGG - Intergenic
929863998 2:45702396-45702418 CTATGAAAACTGATTGTAGTGGG - Intronic
930125072 2:47789367-47789389 ATTTCAAAACTGATAATGGTTGG + Intronic
931333078 2:61308661-61308683 CTTTTATCAATGATTGTGATGGG - Intronic
932112858 2:69017281-69017303 CTTTCCACTCTGGCTGTGGTTGG - Intronic
938151365 2:128887696-128887718 CTTTCATTCCTGATTTTGGTAGG + Intergenic
939660406 2:144882003-144882025 CTTTCAACAAATATGGTGGTGGG - Intergenic
939854323 2:147339652-147339674 CTTTCAGCTCTGATTTTGATGGG + Intergenic
940838453 2:158551913-158551935 CTCTCTAAACTGATTGTGGGAGG + Intronic
942140974 2:172977374-172977396 CTTTGTTCAGTGATTGTGGTGGG + Intronic
943398050 2:187366829-187366851 CTTTCAAGACAAATTGAGGTGGG - Intronic
948542934 2:238702939-238702961 CTTTGAACAATGATTCTGGAAGG - Intergenic
948555093 2:238804113-238804135 CTTTCATCTCTGGTTGTGGCTGG - Intergenic
1171445962 20:25205228-25205250 GTTTCATCACTGCTGGTGGTGGG + Intronic
1181395702 22:22619753-22619775 CTTTCAACACAGAGTGTGGCAGG + Intergenic
1181430324 22:22877583-22877605 CTTTCAACCCAGAGTGTGGCAGG + Intronic
1184553325 22:45217436-45217458 CGTTCAACATTGATTGTTGTTGG - Intronic
949362681 3:3248047-3248069 GTTTCAACACGGATTTTGGGGGG + Intergenic
951711423 3:25587824-25587846 CACTCTACACTGATTGTGTTTGG - Intronic
953689300 3:45104327-45104349 CTTTCCACACTTCTTTTGGTTGG + Intronic
954929593 3:54269580-54269602 CTTTACACAGTGATGGTGGTTGG - Intronic
956176202 3:66475502-66475524 ATTTCAGGACTGAGTGTGGTGGG - Intronic
956410751 3:68976693-68976715 GTTATAACACTGTTTGTGGTAGG - Exonic
957529223 3:81419020-81419042 CTATCAAGACTGATTGTTTTAGG - Intergenic
957794840 3:84990751-84990773 CTTTGAACAGTGATACTGGTTGG - Intronic
958744655 3:98117820-98117842 CTTTCAACTTTGATAGTGATGGG - Intergenic
959638160 3:108599636-108599658 ATTTCAACACTGAATGAGGGGGG - Intronic
963800482 3:149670922-149670944 CTTTCAACTCAGTTTGTGGCTGG + Intronic
964319509 3:155480409-155480431 CTTTCAACTCTCATTATGGGTGG + Exonic
965248896 3:166315608-166315630 ATTTCAACATTGCTTGTGGAAGG - Intergenic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
968895571 4:3400365-3400387 CATTCAACAGTGATTTTTGTGGG + Intronic
970580695 4:17471651-17471673 CTTTCAACATGGCTTGAGGTTGG - Intronic
971712419 4:30132432-30132454 CTTTCAACACTGGTTCTGTTTGG - Intergenic
975372324 4:73603366-73603388 CTCTCCACACTGCTTGTGGCAGG - Intronic
977603733 4:98961312-98961334 GTTTCAACACGGATTTTGGAGGG - Intergenic
979282170 4:118880370-118880392 ATTTTAACACTGATTTTGGGGGG + Intronic
979471310 4:121100829-121100851 CTTTCAACATTAATTTTGGAGGG - Intergenic
979918289 4:126467732-126467754 GTTTTATCACTGATTTTGGTGGG - Intergenic
980975140 4:139604113-139604135 CTTTAAACATCGAGTGTGGTGGG + Intronic
982283743 4:153713411-153713433 CTTTCAAAACTGATTATTTTTGG + Intronic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984998641 4:185462993-185463015 CTTTCAATGCTGATTGTGGTTGG + Exonic
986972786 5:13356455-13356477 GCCTCAACACTGATTATGGTTGG - Intergenic
987048640 5:14130704-14130726 CTTTCAGTACTGAATGTGGCGGG - Intergenic
988209900 5:28189933-28189955 CCTTCAACAATGGTTTTGGTAGG - Intergenic
991344535 5:65649438-65649460 CTTTCTACCCTGCTAGTGGTTGG - Intronic
993147394 5:84112574-84112596 CTTGCTATACTGATTTTGGTGGG + Intronic
997791503 5:136766404-136766426 CATTCAACACTGCTGGAGGTTGG - Intergenic
998543228 5:143003108-143003130 TTATTAACACTGATTGTTGTGGG - Intronic
998878449 5:146623410-146623432 CTTTGTACACTTATCGTGGTGGG - Intronic
998954415 5:147424023-147424045 CTTTCAAAACAGCTTGCGGTCGG - Intronic
1001503116 5:172254715-172254737 CTTGCAACAATGCTTGTGGGGGG + Intronic
1003025717 6:2553837-2553859 CTATCAAAACTGATCATGGTTGG - Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1005092944 6:22078355-22078377 CTTTCAACATTAATTATGGCTGG + Intergenic
1006865788 6:37208108-37208130 ATTTCTACCCTGAGTGTGGTGGG + Intergenic
1009633453 6:66231433-66231455 ATTTCAACATTAATTTTGGTCGG + Intergenic
1011237331 6:85231884-85231906 CTTTCAACAGTGGTTGTTTTAGG + Intergenic
1013675075 6:112450195-112450217 CTTTCAATTCTGTTTGTGTTTGG + Intergenic
1013777725 6:113696963-113696985 CCTTCAACACAGATTTTTGTGGG + Intergenic
1015784934 6:136913015-136913037 CATTCAAGACTGAGTGTGGAAGG - Intronic
1016776773 6:147913192-147913214 TTTTTTGCACTGATTGTGGTTGG - Intergenic
1018552976 6:165019877-165019899 GTTTCAACACTGTTTGTTGAAGG - Intergenic
1021157553 7:17230553-17230575 CCTACAATACTGATTGGGGTGGG - Intergenic
1024023473 7:45391597-45391619 CTTTGAGCTCTGTTTGTGGTGGG - Intergenic
1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG + Intronic
1029493558 7:100885155-100885177 TTTTTATTACTGATTGTGGTGGG - Intronic
1031053641 7:116970717-116970739 CTTTCTGGACTGATTGTTGTAGG + Intronic
1047705596 8:127496406-127496428 CTTTCAAGACTGAGTGAGCTTGG + Intergenic
1050357662 9:4798305-4798327 CTTTAAACAATTATTCTGGTGGG - Intronic
1050568663 9:6914601-6914623 GTTTCATCACTAATTGTGGAGGG - Intronic
1052050999 9:23849950-23849972 TTTTCAAAACTGCTTGTGCTGGG + Intergenic
1053214834 9:36261603-36261625 CTTTCAATACCTCTTGTGGTAGG - Intronic
1053476795 9:38387935-38387957 TTATGTACACTGATTGTGGTAGG - Intergenic
1058024114 9:100121409-100121431 CTCTCAACAGTACTTGTGGTAGG - Intronic
1058790736 9:108442811-108442833 CTTACAACAGGGATAGTGGTAGG + Intergenic
1060870271 9:127034390-127034412 ATTTCAACAGTGATTCTAGTTGG - Intronic
1186128207 X:6438688-6438710 CCTTCAACAGTTTTTGTGGTAGG - Intergenic
1189989256 X:46578816-46578838 CTTTCACCAATGATTGGGCTAGG - Intronic
1194535241 X:95097877-95097899 CTTCTAATACTGATCGTGGTTGG + Intergenic
1201796914 Y:17905916-17905938 CTTTCAGCAGAGACTGTGGTGGG - Intergenic
1201804639 Y:18000069-18000091 CTTTCAGCAGAGACTGTGGTGGG + Intergenic