ID: 983923943

View in Genome Browser
Species Human (GRCh38)
Location 4:173376018-173376040
Sequence ATTTTTGCACAGATTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 393}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983923943_983923952 19 Left 983923943 4:173376018-173376040 CCACCCTCAATCTGTGCAAAAAT 0: 1
1: 0
2: 5
3: 52
4: 393
Right 983923952 4:173376060-173376082 CTCTGGTGCCAAAAAGGTTGGGG 0: 69
1: 1092
2: 1638
3: 1270
4: 987
983923943_983923949 13 Left 983923943 4:173376018-173376040 CCACCCTCAATCTGTGCAAAAAT 0: 1
1: 0
2: 5
3: 52
4: 393
Right 983923949 4:173376054-173376076 ATCTATCTCTGGTGCCAAAAAGG 0: 1
1: 2
2: 22
3: 208
4: 1213
983923943_983923951 18 Left 983923943 4:173376018-173376040 CCACCCTCAATCTGTGCAAAAAT 0: 1
1: 0
2: 5
3: 52
4: 393
Right 983923951 4:173376059-173376081 TCTCTGGTGCCAAAAAGGTTGGG 0: 78
1: 1103
2: 1667
3: 1354
4: 955
983923943_983923947 2 Left 983923943 4:173376018-173376040 CCACCCTCAATCTGTGCAAAAAT 0: 1
1: 0
2: 5
3: 52
4: 393
Right 983923947 4:173376043-173376065 CCTTCCGTGAAATCTATCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 105
983923943_983923950 17 Left 983923943 4:173376018-173376040 CCACCCTCAATCTGTGCAAAAAT 0: 1
1: 0
2: 5
3: 52
4: 393
Right 983923950 4:173376058-173376080 ATCTCTGGTGCCAAAAAGGTTGG 0: 7
1: 160
2: 1207
3: 1831
4: 1478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983923943 Original CRISPR ATTTTTGCACAGATTGAGGG TGG (reversed) Intronic
900914682 1:5628167-5628189 ATTTGTAGACAGATTGAAGGTGG - Intergenic
900933501 1:5751149-5751171 CTTCTTTCACAGATTGAGGGAGG + Intergenic
901714232 1:11140295-11140317 ATTATTCCACAGATTGGGTGGGG + Intronic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
904448221 1:30592283-30592305 ATTTTGGAAGAGATTGAGGAGGG - Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
907481140 1:54746327-54746349 ATTTTTCCACAGGATGGGGGAGG - Intergenic
907597708 1:55734954-55734976 ATTTTTACAAAGATGGAGAGAGG - Intergenic
908888446 1:68816894-68816916 ACTTTTGCAAATATTGAGGAAGG + Intergenic
909711171 1:78651132-78651154 ATTTTTCCACAGACTGGTGGTGG + Intronic
909966359 1:81915645-81915667 ATTTTTGAACAGATATAGGCTGG + Intronic
909994007 1:82256973-82256995 TTTTGTGCACATATTGAGAGAGG + Intergenic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910684186 1:89899506-89899528 ATTTTTGCAGAGCTTTAGGATGG + Intronic
911750622 1:101492923-101492945 ATTTTTGTAGAGATGGCGGGTGG + Intergenic
913508168 1:119538348-119538370 ATTTTTGCAAAAAAAGAGGGTGG + Intergenic
914319902 1:146549113-146549135 ATTTTTCCACAGATTGGGGGTGG - Intergenic
914986530 1:152462093-152462115 ATTTTTGTATGGATTGAGGTAGG + Intergenic
916236495 1:162594053-162594075 ATTTTTCCACAGACTTGGGGTGG + Intronic
916619211 1:166477563-166477585 ATTTTTCCACAGAGTGGGGTGGG + Intergenic
917860647 1:179139910-179139932 ATTTTTTCACAGACTGGGTGGGG - Intronic
918013716 1:180612112-180612134 ATTATTGCATAGATTGTTGGAGG + Intergenic
918064098 1:181088244-181088266 ATTTTTGCCAGGGTTGAGGGGGG + Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
919574822 1:199294645-199294667 GTTATTGGACAGATTGATGGGGG - Intergenic
919962031 1:202480955-202480977 ATTTTTCCACAGACTGGTGGGGG + Intronic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921253212 1:213316756-213316778 ATTTTTACACAGAGTGATTGAGG + Intergenic
922242567 1:223765498-223765520 GTTTCTGCACAGATGGAGGGTGG + Intronic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064558222 10:16568721-16568743 CTTTTTCCACAGACTGTGGGTGG - Intergenic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065009923 10:21411704-21411726 ATTTTTCCACAGATGCGGGGTGG + Intergenic
1065505847 10:26429472-26429494 ATTTTTCCACAGATTGGTGGGGG - Intergenic
1065746648 10:28848432-28848454 AATTTTTCACAGTTTGAGGGAGG - Intronic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1066000476 10:31100228-31100250 AATTTTGCAGAAATTGAGGAGGG + Intergenic
1066329162 10:34399253-34399275 ATTTATGCTCAGATAGAGAGTGG - Intronic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1066643832 10:37584865-37584887 ATTCTTGCACAGTTTGGGTGTGG - Intergenic
1068070583 10:52189631-52189653 ATTTTCCCATGGATTGAGGGTGG - Intronic
1068072322 10:52210590-52210612 ATATTTGCACACAGTGATGGAGG - Intronic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069665306 10:70151536-70151558 ACTTTTGCACAGATTCTAGGGGG - Exonic
1069828255 10:71267451-71267473 ATTTCTGCACTGATGGTGGGTGG + Intronic
1070402817 10:76068405-76068427 ATTATTCCACAGACTGGGGGTGG + Intronic
1070615264 10:77964825-77964847 ATTTTTCCACAGACTGCTGGAGG - Intergenic
1071953898 10:90735836-90735858 ATTTTTGTAGAGATGGGGGGTGG - Intergenic
1072057700 10:91776665-91776687 ATTTTTGTATAGAGTGAGTGGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072365846 10:94708388-94708410 ATTTTTGTACACATTTAGGGGGG + Intronic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1075113362 10:119605818-119605840 CTTTTTGTACAGATTTGGGGGGG - Intergenic
1076415072 10:130280223-130280245 ATTTTTCCACAGACCCAGGGTGG - Intergenic
1076621232 10:131789448-131789470 ATTTCTCCACAGACTGGGGGTGG - Intergenic
1078252446 11:9627451-9627473 TTTTTTGTAGAGATTGGGGGGGG + Intergenic
1078396625 11:10987399-10987421 ATTTTTCCACAGATGGGAGGGGG - Intergenic
1079131261 11:17748217-17748239 ATTTCAGCAAAGATTGAAGGAGG + Intronic
1079228094 11:18625742-18625764 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1080112639 11:28585702-28585724 ATTTTCTCACAGGTTGATGGTGG - Intergenic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080539840 11:33255555-33255577 ATTTTTGCAGACATTTAAGGAGG - Intergenic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081622264 11:44625579-44625601 CTTATTGCATAGATTGATGGAGG - Intergenic
1083142598 11:60734076-60734098 ATTTTTGTAGAGATGGCGGGTGG - Intronic
1084011646 11:66353443-66353465 TTTTTTTTACAGATTGAAGGTGG + Intronic
1085591304 11:77763896-77763918 ATTTGTCCACAGACTGGGGGTGG + Intronic
1085776855 11:79374268-79374290 ACTTTTGCAGGGATTGAGGTGGG + Intronic
1085885608 11:80518287-80518309 ATTTTTCCACATACTGGGGGTGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1087765798 11:102151880-102151902 AATTATGTACAGAGTGAGGGAGG + Intronic
1088318061 11:108527376-108527398 CTTTTTGCAAAGAGAGAGGGAGG + Intronic
1089516451 11:119035349-119035371 ATTTTTGTAGAGATGGCGGGGGG - Intergenic
1090591133 11:128270211-128270233 ATTTTTCCACAGATTGGGGGTGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1092410336 12:8248074-8248096 ATTTTTGCAGAGATGGCAGGTGG + Intergenic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092871681 12:12811252-12811274 TTTTTTGCACAGAATTGGGGCGG - Intronic
1093224538 12:16465778-16465800 ATTTTTCCACAGATTGGGGTGGG - Intronic
1093651062 12:21646147-21646169 ATTTTATAACAGACTGAGGGAGG + Intronic
1094167445 12:27457042-27457064 ATTTTTCCACAGACAGTGGGAGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094645744 12:32322377-32322399 ATTTTTCCACAGATAGGGTGCGG + Intronic
1095184370 12:39184722-39184744 ATTTTTTCACGGATGGGGGGTGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095676230 12:44921953-44921975 ATTTTTGCAAAGACTGTGTGTGG - Intergenic
1096855224 12:54476597-54476619 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1097728995 12:63106502-63106524 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1099425172 12:82514915-82514937 GTATTTGCACATATTGAAGGAGG + Intergenic
1099868764 12:88319658-88319680 ATTTTTTCACAGACTGGTGGGGG - Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100625618 12:96328395-96328417 GTTTTTTCACAGACTGAGGTTGG - Intronic
1101713294 12:107288484-107288506 ATTTTTGTAGAGATTGGCGGTGG - Intergenic
1101775469 12:107789326-107789348 TTGTTTGCACAGAGAGAGGGAGG + Intergenic
1102509313 12:113403539-113403561 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1102549064 12:113677839-113677861 TTTTTGGCAGAGAGTGAGGGCGG + Intergenic
1103113327 12:118302140-118302162 ATTTCTGCACAGATCAAGGAAGG + Intronic
1104722191 12:131050737-131050759 ATTTTTGCACGGATGGGGTGGGG + Intronic
1104849624 12:131865790-131865812 CTTTTTGTAGAGATTGGGGGCGG - Intergenic
1105756444 13:23468772-23468794 GTTTTGGCACAAATTGAAGGAGG + Intergenic
1106303513 13:28490512-28490534 ATTTTATACCAGATTGAGGGAGG - Intronic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106901769 13:34361065-34361087 ACTTCTGCACAGATGCAGGGAGG + Intergenic
1107895347 13:44956391-44956413 ATTTTTCCAAAGACAGAGGGTGG + Intronic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1110909038 13:80932423-80932445 GTTTTTCCACAGACTGGGGGTGG + Intergenic
1111808971 13:93074063-93074085 ATTTTGACACAGATTCAGGAGGG - Intergenic
1112976442 13:105324890-105324912 ATTCTTGCTGATATTGAGGGGGG + Intergenic
1113626694 13:111853110-111853132 ATTTCTCCACAGATGGGGGGTGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115746275 14:36441006-36441028 ATATTTGCAATGATGGAGGGTGG - Intergenic
1116255572 14:42549893-42549915 ATTTTTCCACAGACTGGTGGGGG - Intergenic
1116423756 14:44764794-44764816 ATTTTTCCACAGATCAGGGGTGG - Intergenic
1116516752 14:45814534-45814556 ATTTTTGCCAATATTGAAGGGGG + Intergenic
1118931926 14:70250776-70250798 ATTATAACACAGATTGTGGGGGG + Intergenic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1121242072 14:92438431-92438453 ATTTTTGTAGAGATGGCGGGGGG - Intronic
1121798241 14:96753415-96753437 ATTTTTTCACAGACTGGGTGGGG - Intergenic
1122472767 14:101982674-101982696 ATTTTTCCACAGATGGTTGGGGG - Intronic
1125960142 15:43823146-43823168 ATTTTTGCAGAGATTGGCGGGGG + Intronic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1126136182 15:45394341-45394363 ATTTTTGCACAGATGGGGTGTGG - Intronic
1126177590 15:45752054-45752076 AGTTTTGCATAGAATGAGGTAGG + Intergenic
1127441885 15:59017152-59017174 ATTTTTCCACAGACCCAGGGTGG - Intronic
1127618404 15:60709850-60709872 ATTTTTCCACAGAGTGGGGCAGG - Intronic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1129985126 15:79912333-79912355 ATTTTTCCACGGACTGGGGGTGG - Intronic
1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG + Intronic
1130630220 15:85560317-85560339 TTTTTTGCAAAGAGTGGGGGTGG + Intronic
1130743134 15:86622725-86622747 ATTTTTCCACAGACTACGGGTGG + Intronic
1131605385 15:93898320-93898342 ATATTTGCACATATTTATGGGGG - Intergenic
1132076516 15:98825632-98825654 ATTTTTCCACAGATGGGTGGGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1134286639 16:12867688-12867710 TTTTTTGCAGAGATGGGGGGGGG + Intergenic
1134341476 16:13350740-13350762 ATTTTTGCAAAGAAAGAGTGAGG + Intergenic
1138695510 16:58809109-58809131 TTTTTTGCTCAGATTCATGGAGG + Intergenic
1140013624 16:71160964-71160986 ATTTTTCCACAGATTGGGGGTGG + Intronic
1140375528 16:74442657-74442679 TTTTTTGTAGAGATTGGGGGTGG + Intergenic
1140522905 16:75597510-75597532 ATTTTTCCACAGATCCGGGGTGG + Intronic
1141092687 16:81141148-81141170 ATTCCTGCACACATTCAGGGAGG - Intergenic
1141327741 16:83078322-83078344 ATTTTTCCACATATTGGGGACGG + Intronic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1144850399 17:18241236-18241258 ATTTTGTCACAGATCGAGAGAGG + Intronic
1147412405 17:40263195-40263217 ATTTTTCCATAGATGGTGGGCGG + Intronic
1149140067 17:53421580-53421602 TTTTTTCCACAGACTGGGGGAGG - Intergenic
1149808107 17:59638540-59638562 ATTTTTCCACCGGTTGGGGGTGG + Intronic
1150075843 17:62191433-62191455 TTTTTTGTACAGATGCAGGGTGG - Intergenic
1150786969 17:68170808-68170830 ATTTTTGTAGAGGTTGAGGAGGG + Intergenic
1151279525 17:73062729-73062751 GTTTTTCCACGGATTGGGGGTGG + Intronic
1151573724 17:74940720-74940742 ATTTTTCCATGGATGGAGGGTGG - Intronic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1154291673 18:13113597-13113619 ATTTTTGCCCAGAGGTAGGGGGG + Exonic
1154933273 18:21023382-21023404 ATTGTTACACAGATTGACAGTGG - Intronic
1155519259 18:26652719-26652741 ATTGTTGAACAAATGGAGGGAGG + Intronic
1157538598 18:48481934-48481956 ATTTTTTCACAGACAGAAGGTGG + Intergenic
1157635438 18:49148870-49148892 ATTTTTCCACGGATGCAGGGTGG + Intronic
1159324586 18:66897863-66897885 ATTTTTCCACAGATGGTTGGGGG - Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1161136919 19:2625388-2625410 TTTTTTGCAGAAATAGAGGGGGG + Intronic
1161595035 19:5146760-5146782 TTTTTTGTAGAGATTGTGGGGGG - Intronic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163284728 19:16339217-16339239 ATTCTTGTACAGATGCAGGGAGG - Intergenic
1164957775 19:32401952-32401974 TTTTTTGTAAAGATTGGGGGTGG - Intergenic
1165235835 19:34420893-34420915 ATTTTTTCACAGACTGAGGTGGG + Intronic
1165857005 19:38885271-38885293 ATTTTTGTAGAGATGGGGGGTGG + Intronic
926046565 2:9714260-9714282 ATTTTTGTAGAGATTCGGGGTGG - Intergenic
926177122 2:10603984-10604006 ATTTTTCCACGGATGCAGGGAGG + Intronic
926243710 2:11106652-11106674 TTTTTTGTAGAGATGGAGGGCGG - Intergenic
926859481 2:17293098-17293120 CTTTTTGCAAAAATTAAGGGAGG - Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
929417357 2:41756966-41756988 ATTTTTCCACAGACTGGAGGGGG + Intergenic
929684599 2:44022974-44022996 ATTTTTGGACAGGTTGGGGAGGG + Intergenic
931124210 2:59255681-59255703 ATGTTTGTTCACATTGAGGGAGG + Intergenic
931514665 2:63041375-63041397 ATTTCTGCACACATTGGGGTGGG + Intronic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
931959424 2:67465730-67465752 ATTTTAGCACAGAGAGAGGCAGG + Intergenic
932218080 2:69979564-69979586 CTTTGTGCCCAGTTTGAGGGGGG - Intergenic
932245594 2:70193641-70193663 TTTTTTGTAGAGATTGGGGGTGG + Intronic
932599666 2:73114791-73114813 AAGTTTCCACAGACTGAGGGTGG - Intronic
933058995 2:77711732-77711754 ATTTTAGCAAAGATTTAAGGAGG - Intergenic
933410036 2:81913798-81913820 ATTTTTCCATAGACTCAGGGTGG + Intergenic
934899399 2:98145893-98145915 ATTTTTGCAGAGATTAGGGTTGG + Intronic
935016272 2:99185214-99185236 ATTTTTCCACAGATAGGGAGGGG - Intronic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
937078737 2:119125483-119125505 TTCTTTGCACAGGATGAGGGTGG + Intergenic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
938989821 2:136616352-136616374 ATTTTAGCATTGATTGAAGGAGG - Intergenic
939547493 2:143571290-143571312 ATTTTTTCACAGATTGTAAGGGG - Intronic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
941448370 2:165629022-165629044 TTTCTTCCACAGATTTAGGGAGG - Intronic
941853506 2:170207444-170207466 ATGTTTGCACAGGAAGAGGGAGG + Intronic
942497752 2:176557649-176557671 ATTTTTCCACAGATGTTGGGGGG - Intergenic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
943745173 2:191454694-191454716 ATTTTTTCACAGTTGGAGGTGGG + Intergenic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944777431 2:202981150-202981172 ATTTTTCCACAGACCCAGGGTGG + Intronic
944886153 2:204064638-204064660 ATTTTTCCACACACTGGGGGTGG - Intergenic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946653435 2:221918858-221918880 ATTATTGCCCTGATTGAGAGGGG + Intergenic
946699804 2:222401102-222401124 CTTTTTGCACAAAGTGAGGAAGG + Intergenic
947635295 2:231677622-231677644 TTTTTTGCAGAAATTGCGGGGGG + Intergenic
948120296 2:235524403-235524425 ATTTTTGCACAGCCTGACAGTGG + Intronic
948615072 2:239193256-239193278 AATTTCTCACAGATGGAGGGAGG + Intronic
1169640006 20:7741245-7741267 ATTTTTCCACAGATAGTGGTGGG + Intergenic
1169670536 20:8095523-8095545 ATTTTTGTATAAATAGAGGGTGG + Intergenic
1170453317 20:16508440-16508462 ATTTTTCCACAGATAGGGGTAGG + Intronic
1170501988 20:16983288-16983310 ATTTTTCCACGGAGTGGGGGTGG - Intergenic
1171162340 20:22939163-22939185 TTTTTTCCACAGATAGAGGGAGG - Intergenic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1173336295 20:42114858-42114880 ATTTGGGCAGAGAATGAGGGAGG - Intronic
1174110784 20:48196447-48196469 ATTTTTCCACGGACTGTGGGGGG + Intergenic
1174142560 20:48426040-48426062 ATTATGGCACAGAGTGAGGGAGG - Intergenic
1174794803 20:53513073-53513095 TTTTTTGTAGAGATTGGGGGGGG - Intergenic
1174825268 20:53762828-53762850 ATTTTTGAAGAGTTTGAGGCAGG - Intergenic
1174914657 20:54642306-54642328 ATTGTTCCAGACATTGAGGGAGG - Intronic
1177131124 21:17256996-17257018 TTTTTTGCACAGAATGGGAGAGG + Intergenic
1179547119 21:42120215-42120237 GTGTTTGCACAGATTGCTGGTGG + Intronic
1180100742 21:45583764-45583786 ATTTTTCCACAGATGAGGGGTGG + Intergenic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1181024247 22:20118735-20118757 ATCTGTGCACAGACTGATGGGGG - Intronic
1181415666 22:22756938-22756960 TTTTTTGCACAGAATGTGGAGGG - Intronic
1182403825 22:30106528-30106550 ATATTTGGACAGATTGAGAGGGG + Intronic
1183306588 22:37086181-37086203 TTTTTTGCCCAAATTGAGGATGG - Intronic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
1185211806 22:49574798-49574820 ATTATAGCACAGATTGCGTGGGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949775576 3:7629000-7629022 ATTATTGCAAAGTTTGAGGATGG - Intronic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952186164 3:30971394-30971416 ATTTTCTCACAGATTGAGGTAGG + Intergenic
952305154 3:32138888-32138910 AGTTTAGCTCAGATTGAGAGTGG + Intronic
952941510 3:38448428-38448450 ATTTTTGTACAAATTCATGGAGG - Intergenic
953081867 3:39628513-39628535 ATATTTGTACAGATTTATGGGGG - Intergenic
953874379 3:46657659-46657681 ATTTTTCCACAGACTAGGGGCGG - Intergenic
954055243 3:48017893-48017915 ATTTTTCCACAGATAGCAGGAGG + Intronic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
956511154 3:69994795-69994817 ATTTATGCCCAGATTGCAGGTGG - Intergenic
957055576 3:75440204-75440226 ATTTTTGTAGAGATGGAAGGTGG + Intergenic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957846572 3:85744593-85744615 ATGTTTGGACAGAATGAAGGTGG + Intronic
958189186 3:90162623-90162645 ATTTTTCCACAGATTGGTGGTGG + Intergenic
958411498 3:93822255-93822277 ATTTTTCCACAGATTGCTTGGGG + Intergenic
959848757 3:111063912-111063934 ATTTTTGTAGAGATGGGGGGGGG - Intergenic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
960960199 3:123065356-123065378 AGTTTTCCACAGATGGTGGGGGG + Intergenic
962518292 3:136174041-136174063 CTTTTTCAACAGATTGAGGGAGG - Intronic
963305515 3:143648301-143648323 ATTTTTCCACGGATTGGGGGAGG + Intronic
966163400 3:176991079-176991101 ATTTCTCCACAGACTGGGGGTGG + Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
966722831 3:183081372-183081394 ATTTTGGCAGAGATTTAAGGAGG - Intronic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
970514153 4:16810941-16810963 ATTTTTCCACAGACTGGTGGGGG + Intronic
970929855 4:21496892-21496914 ATTTTTGCACAGACAGAGCAGGG - Intronic
971384921 4:26133738-26133760 ATTTTTCCATAGACTGGGGGCGG - Intergenic
972675090 4:41252316-41252338 ATTTTTCCACGGACTGGGGGTGG + Intergenic
973018076 4:45166384-45166406 ATTTTTTCATAGACTGGGGGTGG + Intergenic
974272276 4:59665945-59665967 ATATTAGCACAGCTTGAGAGTGG - Intergenic
975450319 4:74518084-74518106 GTTTTTGCCCAGTTTGAGTGAGG + Intergenic
976413359 4:84742772-84742794 GTTTTTCCACAGACTAAGGGGGG - Intronic
976417901 4:84800683-84800705 ATTTTTTCACAGATGGATTGTGG + Intronic
976456748 4:85256699-85256721 TTTTTTCCACAGATTGAAGAGGG + Intergenic
977475962 4:97509960-97509982 ATTTTTCCACGGATTAGGGGTGG - Intronic
977775438 4:100914079-100914101 TTTTTTCCACAGACTGGGGGAGG - Intergenic
977923585 4:102672852-102672874 GTTTTTCTACAGATTGGGGGTGG - Intronic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
980026762 4:127777497-127777519 TTTTTTGCACAAATTGGGGGAGG + Intergenic
981734741 4:147937072-147937094 ATTTTTCCACCGATTGGGGTGGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982858221 4:160412719-160412741 ATTTTTCCACAGACTGCGTGGGG - Intergenic
983193931 4:164783750-164783772 ATTTTTTCAGAGATGGAGGTGGG - Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985164038 4:187074016-187074038 GTTTTTGCACAGAGAGAGGCTGG + Intergenic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
987230702 5:15890677-15890699 ATTTTTTCACACATGCAGGGAGG - Intronic
988200397 5:28062109-28062131 ATTTTTCCACAGCTTTATGGAGG + Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988884163 5:35537087-35537109 ATATTTACATAGTTTGAGGGTGG + Intergenic
989330771 5:40255406-40255428 ATTTTAGCACCTAATGAGGGAGG + Intergenic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
992485650 5:77191722-77191744 ATATTTCCACAGATCGAAGGTGG + Intergenic
992756227 5:79908985-79909007 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
993469105 5:88285331-88285353 TTTTTTGTACAGATGGGGGGAGG - Intergenic
993515839 5:88834022-88834044 AGTTTTGCACAGATAAAGGGAGG - Intronic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
996926490 5:128833064-128833086 ATTTTTCCATGGACTGAGGGGGG - Intronic
997098165 5:130937408-130937430 ATTTTTCCGCAGATGAAGGGGGG - Intergenic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
999512640 5:152268708-152268730 ATTTTTCCACAGATGGTTGGGGG + Intergenic
999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG + Intergenic
1000787205 5:165559883-165559905 ATTTTTGCAAATCTTGAGGGAGG + Intergenic
1000811918 5:165874027-165874049 ATATTTGCACACATTTATGGGGG - Intergenic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1002625787 5:180528008-180528030 AATTTTCCACAGATTTGGGGAGG - Intronic
1004023361 6:11795108-11795130 ATTTTCACACAGTTTGAGGATGG - Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004802616 6:19167224-19167246 ATTCTGGCAGAGATGGAGGGTGG - Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005086242 6:22009754-22009776 ATTTTTATTCAGATTTAGGGAGG - Intergenic
1005972203 6:30770133-30770155 ATTTGCTCACAGATTGAAGGAGG - Intergenic
1006237311 6:32645310-32645332 ATTTTTCCACAGATAGTTGGGGG + Intronic
1007628149 6:43258123-43258145 CTCTATGCTCAGATTGAGGGTGG - Intronic
1008861429 6:56153965-56153987 ATTTTTGGACAGGTTGGAGGTGG - Intronic
1008967487 6:57327851-57327873 ATTTTTCCACGGACTGAGGTCGG + Intronic
1010088631 6:71952216-71952238 ATTTTGGCATAGAGTGATGGTGG - Intronic
1011290520 6:85772298-85772320 ATGATTGCACAGGGTGAGGGAGG + Intergenic
1012037618 6:94162906-94162928 ATTTTTCCATGGATTGGGGGTGG + Intergenic
1012973439 6:105755338-105755360 ATTTTTCCATAGACTGGGGGAGG - Intergenic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014747504 6:125217209-125217231 ATTTTTCCACAGACAAAGGGTGG + Intronic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015725470 6:136295127-136295149 ATTTTTTCATAGACTGAGGGCGG - Intergenic
1015933693 6:138387196-138387218 ATTTTTGTAGAGATGGTGGGGGG - Intergenic
1016477670 6:144445566-144445588 ATCTGACCACAGATTGAGGGCGG - Intronic
1016776773 6:147913192-147913214 TTTTTTGCACTGATTGTGGTTGG - Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1017357643 6:153528484-153528506 GTTCTTTCCCAGATTGAGGGTGG + Intergenic
1017804360 6:157930721-157930743 ATTTTTCCACAGATAGACAGTGG - Intronic
1019985119 7:4650072-4650094 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1020727264 7:11831758-11831780 AGTCTTCCACAGATAGAGGGTGG + Exonic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1020909089 7:14105566-14105588 ATGTTAGAAAAGATTGAGGGGGG + Intergenic
1021000508 7:15324652-15324674 ATTTTCCCACAGATGGTGGGGGG + Intronic
1022201949 7:28125762-28125784 ATGCTTGCACTGAGTGAGGGTGG - Intronic
1022557800 7:31317195-31317217 GTGTGTGCACAGATTTAGGGTGG - Intergenic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025978794 7:66391017-66391039 TTTTTTCCACAGACTGGGGGTGG + Intronic
1026314053 7:69212477-69212499 ATTTTTCCACAGATAAGGGGTGG - Intergenic
1026469807 7:70685531-70685553 ATTTCAGCTCAGTTTGAGGGAGG - Intronic
1026992962 7:74598043-74598065 TTTTTTGCAGAGACGGAGGGAGG - Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028479812 7:91292460-91292482 ATTTTTCCACAGATTGGGGTAGG - Intergenic
1029369294 7:100137876-100137898 ATTGTTGCAAAAACTGAGGGAGG + Intergenic
1032018564 7:128394296-128394318 ATGTCGGCCCAGATTGAGGGTGG - Exonic
1032058528 7:128704207-128704229 GTCTTTCCACAGATGGAGGGTGG + Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1034253097 7:149707822-149707844 GCTTTTTCACAGATTTAGGGAGG - Intergenic
1035326418 7:158068917-158068939 ATTTTAGCACTGATTAAAGGTGG - Intronic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038136989 8:24796969-24796991 ATGTTTGCAGAGATGGAGTGTGG - Intergenic
1039409263 8:37338858-37338880 ATTTCTGCACAAATTGAGCTGGG + Intergenic
1040907451 8:52483280-52483302 ATTTTTCCACAGACCAAGGGTGG + Intergenic
1041351226 8:56949910-56949932 ATTTTTCCACAGACTAAGGCAGG - Intergenic
1041395005 8:57381159-57381181 ATTTCTGCACAGCTTGAAGTCGG + Intergenic
1041819099 8:62009418-62009440 ATTTTTCCAGGGATTGAGGTGGG + Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1041860217 8:62504227-62504249 ATTTTTCCACAGACTGGTGGTGG - Intronic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1044715352 8:95094928-95094950 TTTTTTGCAGAGTTTGGGGGTGG + Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1046349335 8:112985975-112985997 GTTTTTCCACAGATCGGGGGTGG - Intronic
1047275477 8:123402047-123402069 ATGTCGGCCCAGATTGAGGGTGG + Intronic
1047718162 8:127614870-127614892 TTTTTTGAACAGATTGAGCAAGG + Intergenic
1048358054 8:133669759-133669781 ATTTTTGTAACGAGTGAGGGAGG + Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1049632683 8:143667074-143667096 GTGTTTGCACAGAGGGAGGGAGG - Intergenic
1050127632 9:2375836-2375858 AGTTTTCCACAGATGGTGGGTGG + Intergenic
1050911728 9:11080187-11080209 ATCTTTGAACAGATTGAGTGTGG - Intergenic
1051468849 9:17411794-17411816 ATTTTTGCATGGATAGGGGGTGG - Intronic
1052564778 9:30135484-30135506 ATTGTTGCACAGAGTGTGTGAGG + Intergenic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1053728555 9:41028635-41028657 ATTTTTCCACAGACTCGGGGAGG + Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1057995008 9:99813899-99813921 CTGGTTGCCCAGATTGAGGGAGG - Intergenic
1058075778 9:100649279-100649301 ATTTTTGTACAAATGGAGAGGGG + Intergenic
1058748521 9:108015936-108015958 ATTTAGGCAAAGATTGAAGGAGG - Intergenic
1059563878 9:115363221-115363243 ATTTTTCCATGGACTGAGGGGGG + Intronic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061494546 9:130964504-130964526 ATTTTTGTAGAGATTGGGGTGGG + Intergenic
1061675820 9:132215063-132215085 TTTTTTGTAGAGATTGGGGGGGG + Intronic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1186008738 X:5105607-5105629 ATGTTTGCACACACTGAGAGTGG - Intergenic
1186023185 X:5279890-5279912 AGTTTTCAACAGATTGAGTGAGG - Intergenic
1186103927 X:6185757-6185779 ATTATTGCACAGATTGATCTTGG - Intronic
1186221712 X:7356169-7356191 ATTTTTCCACAAACTGGGGGTGG - Intergenic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187414201 X:19078376-19078398 TTTTTTGTAGAGATGGAGGGGGG - Intronic
1187554137 X:20335110-20335132 AGGTTTGCAAAGATTGATGGAGG + Intergenic
1187663534 X:21576913-21576935 ATTTTTGTATTGATTGAGTGTGG + Intronic
1187909121 X:24094082-24094104 ATTTTTTCACAGATAGGGGGTGG - Intergenic
1187944876 X:24416207-24416229 ATTTTGGGAGAGATTGAGGCGGG + Intergenic
1188286186 X:28327865-28327887 ATTCTGGCTCAGACTGAGGGTGG + Intergenic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190077258 X:47326485-47326507 ATTTTTGTAGAGATTGAAGGGGG - Intergenic
1190887990 X:54546030-54546052 ATTTTTGTAGAGATGGGGGGAGG + Intronic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1191209883 X:57873377-57873399 ATTTTTGCAAAAATTCAAGGAGG + Intergenic
1191615673 X:63167312-63167334 ATCTCTGCACAGAGAGAGGGCGG - Intergenic
1191620625 X:63211611-63211633 ATCTCTGCACAGAGAGAGGGCGG + Intergenic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1192956449 X:76075833-76075855 TTTTTTCCCCAGACTGAGGGTGG - Intergenic
1193260564 X:79402315-79402337 ATTTTTTGAAAGATTGAGGAGGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1193763899 X:85502198-85502220 ATTTTTATACAGATTGATGCAGG + Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195959000 X:110365790-110365812 ATTATTGCAAAGAGTGAGCGAGG + Intronic
1196221002 X:113112311-113112333 ATTATTGCACACCTTGAAGGCGG + Intergenic
1197180787 X:123533824-123533846 ATTATTAAAAAGATTGAGGGAGG - Intergenic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG + Intergenic
1200825297 Y:7632245-7632267 ATTTTTCCACAGATCATGGGTGG + Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic
1201361299 Y:13152805-13152827 AGTTTTCCAGAGATTGGGGGGGG + Intergenic
1201782988 Y:17743820-17743842 ATTGTTGCAAAGATTAAGTGGGG - Intergenic
1201818565 Y:18162167-18162189 ATTGTTGCAAAGATTAAGTGGGG + Intergenic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic
1202202602 Y:22369112-22369134 ATTTTTCCACAGATAATGGGTGG - Intronic
1202234759 Y:22698841-22698863 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202297178 Y:23371871-23371893 ATTTTTCCACAGACTGGTGGAGG + Intergenic
1202308400 Y:23497327-23497349 ATTTTTCCACAGATCATGGGTGG + Intergenic
1202562401 Y:26173259-26173281 ATTTTTCCACAGATCATGGGTGG - Intergenic
1202573629 Y:26298726-26298748 ATTTTTCCACAGACTGGTGGAGG - Intergenic