ID: 983929457

View in Genome Browser
Species Human (GRCh38)
Location 4:173436998-173437020
Sequence GTTTCTGGTTATTTTGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983929457_983929463 25 Left 983929457 4:173436998-173437020 CCATACCCAAAATAACCAGAAAC No data
Right 983929463 4:173437046-173437068 AATTCTTCTCTGCGGAATCCAGG No data
983929457_983929462 17 Left 983929457 4:173436998-173437020 CCATACCCAAAATAACCAGAAAC No data
Right 983929462 4:173437038-173437060 GAGGCTGCAATTCTTCTCTGCGG No data
983929457_983929461 -2 Left 983929457 4:173436998-173437020 CCATACCCAAAATAACCAGAAAC No data
Right 983929461 4:173437019-173437041 ACATTCATTGCTCAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983929457 Original CRISPR GTTTCTGGTTATTTTGGGTA TGG (reversed) Intergenic
No off target data available for this crispr