ID: 983934500

View in Genome Browser
Species Human (GRCh38)
Location 4:173491801-173491823
Sequence CTGGACATTCACTCCCCAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983934500_983934502 3 Left 983934500 4:173491801-173491823 CCTACTGGGGAGTGAATGTCCAG No data
Right 983934502 4:173491827-173491849 TAAGAGCGTAAACTAGAACAAGG No data
983934500_983934503 7 Left 983934500 4:173491801-173491823 CCTACTGGGGAGTGAATGTCCAG No data
Right 983934503 4:173491831-173491853 AGCGTAAACTAGAACAAGGCTGG No data
983934500_983934504 8 Left 983934500 4:173491801-173491823 CCTACTGGGGAGTGAATGTCCAG No data
Right 983934504 4:173491832-173491854 GCGTAAACTAGAACAAGGCTGGG No data
983934500_983934506 16 Left 983934500 4:173491801-173491823 CCTACTGGGGAGTGAATGTCCAG No data
Right 983934506 4:173491840-173491862 TAGAACAAGGCTGGGTGCGGTGG No data
983934500_983934505 13 Left 983934500 4:173491801-173491823 CCTACTGGGGAGTGAATGTCCAG No data
Right 983934505 4:173491837-173491859 AACTAGAACAAGGCTGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983934500 Original CRISPR CTGGACATTCACTCCCCAGT AGG (reversed) Intergenic
No off target data available for this crispr