ID: 983935628

View in Genome Browser
Species Human (GRCh38)
Location 4:173500960-173500982
Sequence CCTTCCGGGGAGCAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983935622_983935628 -6 Left 983935622 4:173500943-173500965 CCAGGGAACTGCGCTCTCCTTCC No data
Right 983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG No data
983935621_983935628 9 Left 983935621 4:173500928-173500950 CCACTCGAGGTCTCTCCAGGGAA No data
Right 983935628 4:173500960-173500982 CCTTCCGGGGAGCAGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983935628 Original CRISPR CCTTCCGGGGAGCAGAAGGC CGG Intergenic
No off target data available for this crispr