ID: 983938478

View in Genome Browser
Species Human (GRCh38)
Location 4:173518975-173518997
Sequence GGGCCCCGAAGGCAACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983938478_983938482 -4 Left 983938478 4:173518975-173518997 CCACCGGGTTGCCTTCGGGGCCC No data
Right 983938482 4:173518994-173519016 GCCCTTCGGTGCTGTGTAGTCGG No data
983938478_983938487 23 Left 983938478 4:173518975-173518997 CCACCGGGTTGCCTTCGGGGCCC No data
Right 983938487 4:173519021-173519043 GCGCTGTGAGCTAGGCGAACAGG No data
983938478_983938485 1 Left 983938478 4:173518975-173518997 CCACCGGGTTGCCTTCGGGGCCC No data
Right 983938485 4:173518999-173519021 TCGGTGCTGTGTAGTCGGCGTGG No data
983938478_983938486 15 Left 983938478 4:173518975-173518997 CCACCGGGTTGCCTTCGGGGCCC No data
Right 983938486 4:173519013-173519035 TCGGCGTGGCGCTGTGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983938478 Original CRISPR GGGCCCCGAAGGCAACCCGG TGG (reversed) Intergenic
No off target data available for this crispr