ID: 983939046

View in Genome Browser
Species Human (GRCh38)
Location 4:173522797-173522819
Sequence GTGGGATTGGTTTCCTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983939040_983939046 -8 Left 983939040 4:173522782-173522804 CCGGCCCCCGGAAACGTGGGATT No data
Right 983939046 4:173522797-173522819 GTGGGATTGGTTTCCTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983939046 Original CRISPR GTGGGATTGGTTTCCTCTCC CGG Intergenic
No off target data available for this crispr