ID: 983939517

View in Genome Browser
Species Human (GRCh38)
Location 4:173525391-173525413
Sequence GGTCATAGTGGACACCAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983939509_983939517 14 Left 983939509 4:173525354-173525376 CCACGCCGGGTCTGATTCGGCCT 0: 1
1: 0
2: 0
3: 4
4: 35
Right 983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
983939515_983939517 -6 Left 983939515 4:173525374-173525396 CCTGCTGCAGGCAGAGGGGTCAT 0: 1
1: 0
2: 1
3: 31
4: 238
Right 983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
983939510_983939517 9 Left 983939510 4:173525359-173525381 CCGGGTCTGATTCGGCCTGCTGC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 121
983939508_983939517 15 Left 983939508 4:173525353-173525375 CCCACGCCGGGTCTGATTCGGCC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983939517 Original CRISPR GGTCATAGTGGACACCAGCT AGG Intronic
901321552 1:8343285-8343307 GGTCCTCGTGGCCTCCAGCTTGG - Intronic
901378119 1:8854395-8854417 GGTCCCAGTGGACAGCAGCCCGG + Intergenic
904607755 1:31707257-31707279 GGTCTTACTGGCCACCAGGTGGG - Intergenic
906943746 1:50277942-50277964 GGCCAAGCTGGACACCAGCTTGG + Intergenic
908742193 1:67340697-67340719 GTTTATAGTGGACATCATCTTGG + Intronic
908984939 1:70006598-70006620 GTTCTCAGTGGATACCAGCTGGG + Intronic
911339571 1:96620296-96620318 GTTCAAAGTTGACACCAGCATGG - Intergenic
915810880 1:158909602-158909624 ATTCAGTGTGGACACCAGCTTGG + Intergenic
919107076 1:193166978-193167000 GGTCATAGAGAACACTAACTTGG - Intronic
920440405 1:205976984-205977006 GCTCATTCTGGACACCAGCATGG - Exonic
922758558 1:228109842-228109864 GGGCTGAGTGGGCACCAGCTGGG + Intergenic
1065871722 10:29961424-29961446 GTGCACAGTGGACCCCAGCTGGG + Intergenic
1066410233 10:35161448-35161470 GGTCCCAGTGGACTCCAGCCTGG + Intronic
1067283231 10:44888807-44888829 GGCCATCCTGGACACCAGCATGG - Intergenic
1068478848 10:57563309-57563331 TGACCTACTGGACACCAGCTGGG - Intergenic
1070279108 10:75036035-75036057 GGTCATAGTGGCCCCAACCTAGG - Intergenic
1072679163 10:97493509-97493531 GGTCACACTGCACTCCAGCTGGG + Intronic
1072950703 10:99844520-99844542 GGACAGAGTGGAGAGCAGCTGGG + Intronic
1073358555 10:102877353-102877375 GGACTAAGAGGACACCAGCTTGG - Intronic
1074586160 10:114768821-114768843 GTTCAGAGTGGTCACCAGCCCGG - Intergenic
1079328883 11:19517740-19517762 GGTCTTAGGGGACACCAGGGTGG - Intronic
1080888412 11:36387637-36387659 GATCATCGTGGCCATCAGCTGGG + Intronic
1081933096 11:46886151-46886173 GGTGGTAGTGGATACCAGTTTGG - Exonic
1090330945 11:125931896-125931918 GGTCCCCGTGGACCCCAGCTGGG - Intergenic
1095208520 12:39466535-39466557 GGTCTTATTGGACACCATCGCGG - Intergenic
1096316403 12:50570970-50570992 GCTCCTTGTGGACAACAGCTGGG - Intronic
1102677219 12:114667103-114667125 GGTCACATTGGAAACCAGCGAGG + Intergenic
1103044951 12:117728463-117728485 GGTTATAATGGACAGCAGCTGGG - Intronic
1106375368 13:29181416-29181438 TGTCACACTGGACACCAGCCTGG + Intronic
1110065734 13:71103110-71103132 AGTCACAGTGGACAGCAGCTGGG - Intergenic
1117488617 14:56224345-56224367 GGTCATAGTCACCACCAGGTGGG - Intronic
1119032133 14:71200971-71200993 GCCCATGGTGGACACCAGCAAGG + Intergenic
1121022187 14:90587044-90587066 GGTGGTAGAGGACAGCAGCTTGG - Intronic
1121112285 14:91320691-91320713 GTTCTTGGGGGACACCAGCTGGG - Intronic
1122404290 14:101490742-101490764 GGGCATAGTAGACAACCGCTGGG + Intergenic
1123121448 14:105918811-105918833 GGTCATGGTGGGTTCCAGCTGGG + Intronic
1124954414 15:34350724-34350746 GGTCATAGTGGGCTTCAGCCGGG - Exonic
1132567350 16:629648-629670 GGGCATAGCAGACACCAGATTGG - Intronic
1132788885 16:1673891-1673913 GTTCATCATGCACACCAGCTGGG - Exonic
1132864809 16:2088055-2088077 GGGCCTTGTGGACACCAGCGTGG + Exonic
1133511326 16:6460301-6460323 GGTCATAGTGGACAACCTATAGG + Intronic
1134203340 16:12217005-12217027 GGTATTAGGGGACACCTGCTGGG + Intronic
1136007930 16:27343906-27343928 GGGCATAGTGTACACCATTTGGG + Intronic
1137811798 16:51359600-51359622 TGTCATAGTGGTTAGCAGCTCGG - Intergenic
1140834507 16:78780800-78780822 GATCGTGGTGGATACCAGCTAGG + Intronic
1141504428 16:84465298-84465320 GGTCAGAGTGGACCCCTGCCAGG + Intergenic
1142782294 17:2190599-2190621 GGTCTTCGTGGACTCCAGGTTGG + Intronic
1143632646 17:8147738-8147760 TGTCACCATGGACACCAGCTGGG - Exonic
1145099792 17:20065210-20065232 AGAAGTAGTGGACACCAGCTAGG + Intronic
1145976920 17:28989080-28989102 GGAGGTAGTGGGCACCAGCTAGG + Intronic
1147141428 17:38462827-38462849 GGTCCTAGTGGGCATCAGCCAGG - Exonic
1155140714 18:23041961-23041983 GGTCTTTGTGGACACCAACCGGG - Intergenic
1155636446 18:27961368-27961390 GGTCATAGCCCTCACCAGCTGGG - Intronic
1156782563 18:40868669-40868691 TGTCATAGAGTACACCAGCTAGG - Intergenic
1157126487 18:44961030-44961052 CATCATTCTGGACACCAGCTGGG - Intronic
1159001087 18:62975680-62975702 GGTCATAGCAGAAACTAGCTAGG + Intronic
1160924196 19:1535261-1535283 GGTCAGAGTGGACCCCTGCATGG + Exonic
1162030412 19:7914805-7914827 GGCCAGAGCAGACACCAGCTGGG - Intergenic
1163262691 19:16200654-16200676 GGTCACCGAGGACACCAGCGTGG + Intronic
1163594053 19:18210736-18210758 GGTCAGAGTGGACCCCAGCCAGG + Exonic
1166126671 19:40718882-40718904 GGTCACAGGGGAGACCAGGTGGG - Intronic
1166383524 19:42368303-42368325 GAGCAAAGTGGACACTAGCTGGG - Intronic
1167594906 19:50422475-50422497 GGTCATAGAAGACGCCATCTGGG - Exonic
1168137449 19:54360819-54360841 GGCCACAGAGGACAGCAGCTGGG + Intronic
925221651 2:2146587-2146609 GGACACAGGGGACAGCAGCTTGG - Intronic
932153816 2:69397029-69397051 GGTGATAGAGCACTCCAGCTTGG + Intronic
938185768 2:129230526-129230548 GGACATAGAGGACACCTGCCAGG + Intergenic
942332976 2:174848246-174848268 GGTCATAGTGGAAGCCAGTTGGG + Intronic
1174077352 20:47947240-47947262 GTTCATTGCAGACACCAGCTTGG + Intergenic
1178817328 21:35943508-35943530 GGTCATTGTGGACACCTTGTAGG + Intronic
1180022438 21:45136775-45136797 GGCCCCTGTGGACACCAGCTGGG - Intronic
1180720777 22:17906761-17906783 GGTCAAAGAGGACATGAGCTGGG + Exonic
1181599624 22:23941804-23941826 GGCCATCCTGCACACCAGCTAGG + Intergenic
1181608883 22:23999502-23999524 GGCCATCCTGCACACCAGCTAGG - Intergenic
1183361746 22:37386504-37386526 GGTCAGTATGGACACCAGCTGGG + Intronic
1183685057 22:39356914-39356936 GCTCCTAGTGGACTCCAGGTTGG + Intronic
1185071606 22:48659663-48659685 GCTCAGAGAGGACAGCAGCTGGG - Intronic
949648800 3:6130797-6130819 GGTCATTGTGGAAAACAGCTTGG - Intergenic
950884187 3:16348487-16348509 GGACACAGTGGGCTCCAGCTGGG - Intronic
952705751 3:36376401-36376423 GCTAATAGTGGATGCCAGCTGGG + Intergenic
954457570 3:50608168-50608190 GGACATAGTGGAAATTAGCTGGG + Intronic
956749558 3:72335309-72335331 GCTCTTAGAGGACACCCGCTGGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961365575 3:126397546-126397568 GGTCATAGGGTACCCCAACTAGG - Intronic
961684811 3:128622444-128622466 GGTCAGAGTGGACCCAAGCCTGG - Intronic
967340936 3:188397343-188397365 GGTCATAGAGAACCCCAGCTAGG - Intronic
970992346 4:22227385-22227407 GGTCATTGTGGAAAGCAGTTTGG + Intergenic
975474060 4:74802099-74802121 AGTCATCGTGGAAAGCAGCTTGG + Intergenic
977253239 4:94711666-94711688 GGTCAAATTCGACACCAGCCTGG - Intergenic
979907838 4:126318551-126318573 AGTCATATGGAACACCAGCTGGG + Intergenic
982035819 4:151344634-151344656 GGTCATAGTGGGCAACAGATGGG + Intergenic
982300746 4:153877152-153877174 TGTAACAGTGGTCACCAGCTGGG + Intergenic
983939517 4:173525391-173525413 GGTCATAGTGGACACCAGCTAGG + Intronic
986428893 5:7662422-7662444 CGGCATAGTGGCCACCAGCACGG + Intronic
996287798 5:121815366-121815388 GGTCCTAGGAGCCACCAGCTGGG - Intergenic
998331143 5:141328274-141328296 CACCAAAGTGGACACCAGCTGGG + Intergenic
999734900 5:154505864-154505886 GGTCACAGTGTGCACCAGGTAGG - Intergenic
1006052244 6:31354123-31354145 GGTCACAGTGGACACAAGGGTGG + Exonic
1010175200 6:73020091-73020113 TTTTAGAGTGGACACCAGCTGGG + Intronic
1016340321 6:143054971-143054993 GCTCATAGTGGACTGCAGTTGGG - Intergenic
1017907145 6:158764686-158764708 GGTCAAAGGGGTCTCCAGCTGGG - Exonic
1018523882 6:164685598-164685620 AGTCATAGTGGAGACCACATTGG + Intergenic
1023314134 7:38917692-38917714 GGACTCACTGGACACCAGCTGGG - Intronic
1027660359 7:80981296-80981318 AGACATAGTGGACCCCAGATAGG + Intergenic
1029585739 7:101469783-101469805 AGAAATCGTGGACACCAGCTGGG - Intronic
1029735116 7:102461291-102461313 CGTGCTAGTGGACACCAGCCTGG + Intronic
1033670554 7:143488791-143488813 GGTCATAGTGGCCTCCAGTGTGG - Intergenic
1039738451 8:40357532-40357554 AGTCACTGTGGACACCAGTTTGG + Intergenic
1040490809 8:47920283-47920305 AGACATAGCCGACACCAGCTCGG - Intronic
1040748993 8:50682646-50682668 GGTCAAAGTGGGAACCAGGTGGG - Intronic
1042677075 8:71332978-71333000 GGACCTAGTGGAGACCAGGTTGG - Intronic
1042948364 8:74176786-74176808 GGTCACTGTGGTCACCATCTTGG - Intergenic
1050242939 9:3657996-3658018 GGTGACAGTGGACACCATCCTGG - Intergenic
1053311096 9:37020556-37020578 TGTCATATTGGACAGCTGCTGGG + Intronic
1054919718 9:70530087-70530109 GGTCAATGTGAACACCAGCCGGG + Exonic
1055646305 9:78364607-78364629 GGTCACACTGCACACCAGCCTGG - Intergenic
1060341762 9:122783548-122783570 GGTCAGCATGGAGACCAGCTGGG + Intergenic
1061150698 9:128826480-128826502 TGTCAAAGTGGAGACCAGGTAGG - Intronic
1061534025 9:131236492-131236514 GGTCAAAGTGGGAACCAACTTGG - Intergenic
1062520447 9:136955500-136955522 GGTCATAGTGGTCACACTCTGGG - Intronic
1185956442 X:4495995-4496017 GGTCATGTTGGACACCATTTTGG + Intergenic
1186194210 X:7095411-7095433 GACCATAGTGGACACCAACAAGG + Intronic
1186914826 X:14208071-14208093 GTACGTACTGGACACCAGCTGGG + Intergenic
1188949943 X:36358754-36358776 GTTCATGGTGAAAACCAGCTGGG - Intronic
1190328144 X:49219251-49219273 TGTCCTAGTGGGCACAAGCTGGG - Intronic
1193898878 X:87150529-87150551 AGTCATTGTGGAAACCAGTTTGG - Intergenic
1195736550 X:108018235-108018257 GGTCAGTGTGGATGCCAGCTGGG + Intergenic
1195850344 X:109275991-109276013 GGTCCTAAGGAACACCAGCTGGG + Intergenic
1198647138 X:138821245-138821267 GTTGCTAGTGGACACCATCTTGG - Intronic
1201566092 Y:15366735-15366757 GACCATAGTGGACACCAACAAGG + Intergenic
1201916072 Y:19182506-19182528 GGTCATTGTCAACACCATCTTGG - Intergenic