ID: 983939540

View in Genome Browser
Species Human (GRCh38)
Location 4:173525486-173525508
Sequence GTTCCAGGATGGAAACCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983939531_983939540 12 Left 983939531 4:173525451-173525473 CCGAGGCCAAGTTGCGAACATCA 0: 1
1: 0
2: 1
3: 4
4: 69
Right 983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 130
983939532_983939540 6 Left 983939532 4:173525457-173525479 CCAAGTTGCGAACATCACCCTGA 0: 1
1: 0
2: 0
3: 4
4: 75
Right 983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 130
983939530_983939540 13 Left 983939530 4:173525450-173525472 CCCGAGGCCAAGTTGCGAACATC 0: 1
1: 0
2: 1
3: 7
4: 118
Right 983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG 0: 1
1: 0
2: 1
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983939540 Original CRISPR GTTCCAGGATGGAAACCCTC TGG Intronic
900265095 1:1753330-1753352 GTGCCAGGGGGGACACCCTCAGG + Intronic
901547247 1:9967581-9967603 GTTCCAGAAAGAAAATCCTCTGG + Intronic
903392820 1:22976701-22976723 GTTCATGGATGGAAAGCCCCTGG - Intergenic
906088687 1:43158380-43158402 GGTTAAGGATGGAAACCCTGAGG + Intergenic
906101409 1:43266072-43266094 GTTTCAGGATGGACACTCTTGGG - Intronic
912566533 1:110591704-110591726 GTTCCAGATTAGAAACCCTTGGG + Intergenic
915311977 1:155009517-155009539 GGTCCAGGGTGGGCACCCTCCGG + Intronic
916424783 1:164670134-164670156 TTTCCATGGTGGAAGCCCTCAGG - Intronic
920261979 1:204694522-204694544 GCTTCAGGATGGAGACCCTGTGG + Intergenic
923201314 1:231715062-231715084 GATCCAGTATGAAAACCTTCAGG + Intronic
1062948589 10:1478886-1478908 GTGCCAAAATGGGAACCCTCAGG + Intronic
1063955475 10:11261509-11261531 GTTCCAGGGCAGACACCCTCAGG + Intronic
1065233304 10:23621250-23621272 GTTACAGGATTGAAACCATTTGG - Intergenic
1065383514 10:25112906-25112928 GGGACAGGAGGGAAACCCTCAGG - Intergenic
1069541837 10:69300256-69300278 GTTCAAGAATGGAAAAGCTCTGG - Intronic
1069874733 10:71554836-71554858 TTTCCTGGATGGAAACACTGAGG + Intronic
1072019600 10:91384958-91384980 GTTCCATGAGGGAAAGCCCCAGG + Intergenic
1072681544 10:97511010-97511032 GCTCCAGGAAGGAAGCCCTGGGG - Intronic
1077295772 11:1825627-1825649 GCTCCAGGCCCGAAACCCTCTGG + Intergenic
1077920671 11:6639830-6639852 GTTCCAGGCTGGGTGCCCTCAGG + Exonic
1077958034 11:7042465-7042487 ATTCCATGATGGAAATCTTCAGG - Exonic
1078110127 11:8385512-8385534 ATTACAGGATAGGAACCCTCTGG - Intergenic
1078611603 11:12824527-12824549 GTTCCCGGATGGAAACAATCGGG - Intronic
1083646592 11:64174981-64175003 GCTCCAGGAACGAAACCCCCTGG - Intergenic
1083891113 11:65596226-65596248 GTTCCATGAAGGAAACACCCTGG + Intronic
1087882271 11:103431416-103431438 GATCCAGGATGTAAACCCCCAGG - Intronic
1087963761 11:104386697-104386719 GTTCCAAGTTGGACACACTCAGG - Intergenic
1088884811 11:113998463-113998485 TTTCCAGGACAGAAACTCTCCGG - Intergenic
1089636953 11:119820934-119820956 GTCCCAGGGTGGGAACCCCCAGG - Intergenic
1091237506 11:134031926-134031948 TTTCCAGGACTGAAGCCCTCGGG + Intergenic
1092256546 12:6928988-6929010 CTTCCACGCTGGAAAACCTCCGG - Intronic
1094631530 12:32180231-32180253 GGTCCAGGCAGGAAATCCTCTGG - Intronic
1096487645 12:51994485-51994507 GGTCCCCGAAGGAAACCCTCAGG - Intronic
1100770801 12:97920903-97920925 CTTCCAGGCTGGAAAATCTCTGG + Intergenic
1102590878 12:113955922-113955944 GTTTCAGGAAGAGAACCCTCTGG - Intronic
1106837895 13:33655845-33655867 GTTGCAGGTTTGAAATCCTCAGG + Intergenic
1108746112 13:53396357-53396379 GTTATAGGATGAAAACCCTAAGG - Intergenic
1109805423 13:67434443-67434465 GTTCCAGAATGCAAAAGCTCAGG - Intergenic
1112664157 13:101550380-101550402 GTTCCAGGAGAGGAACCCTCAGG - Intronic
1118809866 14:69265249-69265271 CTTCCAGGAAGGTAACTCTCGGG - Intronic
1120088499 14:80303928-80303950 GTTCCAGGATGAAAACCATGTGG - Intronic
1120568737 14:86091778-86091800 GTTGCAGGCAAGAAACCCTCAGG - Intergenic
1121730656 14:96184890-96184912 TTGCCAAGATGGAAACCATCTGG + Intergenic
1124240908 15:28027015-28027037 GATCCAGAATGGAAGCCCACTGG + Intronic
1124900469 15:33818004-33818026 GCTCCAGGATGGCAGCTCTCAGG + Intronic
1125918815 15:43512184-43512206 GTTCCAGGAGAGAATCCCTGTGG - Intronic
1126937704 15:53729522-53729544 GGTCCAGCATGGAATCCCACAGG - Intronic
1129123076 15:73414824-73414846 GTTCCAGCATGGGAAACTTCAGG + Intergenic
1129846730 15:78771276-78771298 GTTCCAGGAGAGCAACCCTGGGG - Exonic
1130255168 15:82322615-82322637 GTTCCAGGAGAGCAACCCTGGGG + Intergenic
1130599806 15:85267391-85267413 GTTCCAGGAGAGCAACCCTGGGG - Intergenic
1131565442 15:93481098-93481120 GAGCCAGGAAGGAAACCCTGGGG - Intergenic
1136605390 16:31330202-31330224 GTTCCAGCAGGGAAGCGCTCTGG - Intronic
1141428620 16:83959372-83959394 GGTCCAGGATGGAGACCCCCGGG - Exonic
1145960765 17:28885364-28885386 CTTCCAGGCTGGGAACCCGCTGG + Intronic
1146473665 17:33144651-33144673 ATTCCAAGGTGGAAAACCTCTGG + Intronic
1149638626 17:58189478-58189500 GGTCCAGGCTGGAAAGCCCCTGG + Intergenic
1150837851 17:68580637-68580659 GTCCCAGGGTGGAAACCACCTGG + Intronic
1153140959 18:1972038-1972060 GGTTCAGGTTGGAAAGCCTCAGG - Intergenic
1155335954 18:24765529-24765551 GGACCTGGATGGAAAACCTCTGG + Intergenic
1157258299 18:46157514-46157536 GTCCCAGGAGGGAAACCCCGGGG + Intergenic
1157299298 18:46467977-46467999 GTGCCCGGATGGGACCCCTCGGG - Intergenic
1157844984 18:50994874-50994896 GTTCCAGAATGAAAAGCCTCTGG + Intronic
1160490704 18:79334858-79334880 GTTCCAGGTAGGAGACCCACCGG + Intronic
1160566492 18:79789554-79789576 CTCCCAGGATGGAAACCCCACGG + Intergenic
1161454402 19:4362903-4362925 GGTCCAGGCTGGAGGCCCTCTGG - Intronic
1163573850 19:18099133-18099155 GCTCCAGGTTGGAGACCCGCCGG - Intronic
1163661092 19:18578032-18578054 CCCCCAGGATGAAAACCCTCTGG + Intronic
1165123080 19:33575278-33575300 GTTCCAGGAGGGAAATCCTCAGG + Intergenic
1165723971 19:38099970-38099992 CTTCCAGGATGGAGCCCCGCAGG - Exonic
1167461903 19:49629571-49629593 GTTCCAGGATGGAAAACGGGTGG + Intergenic
925044851 2:765124-765146 GGGCCAGGATGGAGGCCCTCAGG - Intergenic
926363911 2:12115627-12115649 TTCCCAGGATGGAAATCCTTAGG + Intergenic
927182277 2:20455119-20455141 TCTCCATGCTGGAAACCCTCAGG - Intergenic
931120580 2:59214348-59214370 GTTCAAAGATGCAAAACCTCTGG - Intergenic
932126189 2:69147202-69147224 GTTCCAAGATGAAGACACTCAGG - Intronic
932860481 2:75286312-75286334 ATTCCAGGATGGAGGCACTCGGG + Intergenic
941640042 2:167977676-167977698 GTTCCAAGACTGAAAACCTCTGG - Intronic
942722040 2:178964320-178964342 GTTAGAGGAAGGAAACCCTGTGG - Intronic
944874374 2:203946981-203947003 GTTCCTGGTTGAAAATCCTCTGG - Intronic
945099722 2:206252806-206252828 ATTCCAGGATGAAAAGCCTGGGG - Intergenic
948481269 2:238252024-238252046 GCTCCAGGGGGGAAAGCCTCAGG + Intronic
1170625329 20:18025906-18025928 GCTCCAGCAGGGAACCCCTCAGG + Intronic
1171385947 20:24769685-24769707 GTTCCAGAATGGTCACCATCAGG + Intergenic
1172115069 20:32568790-32568812 GTTCCAGGACGGAGAGACTCAGG - Intronic
1172234154 20:33358544-33358566 GGTCCATGAGGGAAATCCTCAGG + Intergenic
1172902894 20:38347744-38347766 GTTCCAGGACAAAAAGCCTCGGG + Intronic
1176096243 20:63345792-63345814 GCGCCAAGGTGGAAACCCTCAGG + Exonic
1176144334 20:63558938-63558960 GAACCAGGAAGGAAACCCTGTGG - Intronic
1178039685 21:28626038-28626060 ATACCAGGATTGAAACCCACAGG + Intergenic
1179617521 21:42591465-42591487 GTGTCAGGCTGGAAACTCTCAGG - Intergenic
1180154687 21:45972268-45972290 GGTCCTGCGTGGAAACCCTCTGG + Intergenic
1183874170 22:40764752-40764774 GGTCCAGGTTGGAAAGCTTCTGG + Intergenic
1184100212 22:42338083-42338105 GTCCCAGGAAGAAAACCCTCTGG + Intronic
1184103470 22:42353907-42353929 GTTCCAGCTTGGCAACCCTGTGG - Intergenic
1184675393 22:46039201-46039223 GCTCCAGGAAGGAAACACACAGG + Intergenic
949676768 3:6463453-6463475 CTTTCAGGAAGAAAACCCTCTGG + Intergenic
953554077 3:43928505-43928527 ATTCCAGGAAGGAAACCTTTAGG + Intergenic
954516498 3:51182426-51182448 CCTCCAGGATGGAAACCCCCAGG - Intronic
961182192 3:124886438-124886460 GTTCCAGGAGGCGAGCCCTCCGG + Intronic
962384344 3:134920854-134920876 GCTTCAGTATGGAAACCCTCAGG - Intronic
963064906 3:141255909-141255931 GTTCCAGGCTGGAAAACCTAGGG + Intronic
963433481 3:145239613-145239635 GTGGTAGGATGGAAACCCTTTGG + Intergenic
966865235 3:184255209-184255231 GTTCCAGGTTGAAATCCCACTGG - Intronic
970199986 4:13594466-13594488 ATTCCTTGATGGAAAGCCTCAGG - Intronic
979305332 4:119135873-119135895 GTTCAAGGATAAAAACCATCAGG + Exonic
979619396 4:122781938-122781960 GTTCCATGTTTGAAACTCTCCGG + Intergenic
982302857 4:153898000-153898022 GTAGAAGGATGGAAACCCTGTGG + Intergenic
983939540 4:173525486-173525508 GTTCCAGGATGGAAACCCTCTGG + Intronic
984953292 4:185021654-185021676 GGTGCAGGATGGAGACCCTGGGG + Intergenic
989963878 5:50446629-50446651 GTTGCAGGAAGGAAAGCATCAGG - Intergenic
992085176 5:73271728-73271750 GTGCCAGGATGGACACACACAGG - Intergenic
1003046102 6:2734192-2734214 GTTACAGGATGGAATCTCACAGG + Intronic
1009020491 6:57943797-57943819 GTTTCAGGAAGGATACCCTGGGG - Intergenic
1013421802 6:109973892-109973914 CTTCCAGGATAGAAGCCCTTTGG + Intergenic
1013631658 6:111991809-111991831 GTTCCAAGTTGGAAAGACTCGGG - Intergenic
1016950749 6:149577298-149577320 GTTCCACGAAGGAGACCCACGGG + Intronic
1017828680 6:158103633-158103655 GTTCCAGAATGTAGACCTTCTGG + Intergenic
1020824376 7:13009099-13009121 GTTCTAGGAAGCAAACCCTTAGG + Intergenic
1024823467 7:53361668-53361690 GTTCCATGATGAAAATCCCCAGG - Intergenic
1025019380 7:55468634-55468656 GGCCCAGGATGGAACCCCTCTGG + Intronic
1027004872 7:74684590-74684612 GTCCCAGGAAGGAAACTCTTGGG + Intronic
1030620814 7:111789338-111789360 TTTCCAGGATGTAAATCCTTTGG + Intronic
1031560877 7:123236641-123236663 TTTCCAGGAATCAAACCCTCAGG + Intergenic
1033568439 7:142602383-142602405 CCTCCAGGGTGCAAACCCTCTGG + Intergenic
1034680458 7:152924469-152924491 ATCCCAGGCTGGAAACCCCCAGG - Intergenic
1035677261 8:1464370-1464392 CTTCCAGGATGGCACCCTTCCGG + Intergenic
1039327921 8:36505071-36505093 GTTCCATAATGGAAACCTCCAGG + Intergenic
1040575187 8:48645779-48645801 CTTCCAGGCTCCAAACCCTCTGG - Intergenic
1040819285 8:51537268-51537290 GCTGCAGGCTGGACACCCTCTGG + Intronic
1043090490 8:75895723-75895745 GTCACAGCAAGGAAACCCTCAGG + Intergenic
1045531320 8:102988006-102988028 ATTCCAGGAGTCAAACCCTCAGG + Intergenic
1046789560 8:118306514-118306536 GTTCCAGGATGGAACTCCAGTGG - Intronic
1055321522 9:75087923-75087945 GCTCCAGCACAGAAACCCTCTGG + Intronic
1056621507 9:88218543-88218565 GGTACAGGATGGAAACCAACAGG - Intergenic
1057502387 9:95605921-95605943 GCTCCAAGAAGGAGACCCTCGGG - Intergenic
1062056963 9:134473796-134473818 GTTCCATGCTGGAACCTCTCTGG + Intergenic
1062384551 9:136303999-136304021 GGCCCACGATGGAAACCCTCAGG + Exonic
1189972491 X:46432646-46432668 GCAGCAGGCTGGAAACCCTCAGG - Intergenic
1200251779 X:154557862-154557884 GTTCCCGTCTGGAAACGCTCAGG - Intronic
1200253986 X:154569546-154569568 GTTCCCGTCTGGAAACGCTCAGG - Intergenic
1200263783 X:154634862-154634884 GTTCCCGTCTGGAAACGCTCAGG + Intergenic
1200265988 X:154646554-154646576 GTTCCCGTCTGGAAACGCTCAGG + Intergenic
1202020876 Y:20463512-20463534 GTTTCAGGATGGAAAACCCTTGG + Intergenic