ID: 983939817

View in Genome Browser
Species Human (GRCh38)
Location 4:173527298-173527320
Sequence CGGGCTGGCCGCAGCACGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983939817 Original CRISPR CGGGCTGGCCGCAGCACGTC TGG (reversed) Exonic
900129127 1:1080216-1080238 AGGGGCGGCCCCAGCACGTCAGG - Intergenic
900387224 1:2416209-2416231 GGAGCTGGACGCAGCAGGTCGGG + Intergenic
900636966 1:3670792-3670814 CGGGCGGGGCCCAGCAGGTCAGG - Intronic
911638928 1:100266596-100266618 CGAGCCGGCCGGAGCACGCCAGG + Exonic
911647542 1:100352502-100352524 CGGGCTGGCAGCAGCTGCTCCGG - Exonic
922809157 1:228406420-228406442 CGGGCTGGCCCCAGCAGCGCCGG + Exonic
1074088389 10:110226010-110226032 CGGGCTGCCCGCGGCACGGCGGG + Intronic
1075961219 10:126568947-126568969 CGGGCTGGCAGGAGGAGGTCTGG + Intronic
1076922264 10:133460114-133460136 CGGGCTGGGGGCGGCACGACTGG + Intergenic
1077079634 11:719473-719495 CAGGCTGGCCGCAGATCCTCAGG + Intronic
1077090494 11:776401-776423 CAGGCTGGGGGCAGCACTTCAGG - Intronic
1077122710 11:917642-917664 CGGTCTGGCCTCAGCTGGTCTGG + Intergenic
1077316425 11:1921293-1921315 CGGGCTGGGCACAGCAGGGCGGG + Intronic
1091406030 12:210075-210097 AGGGCTGGCGGGAGCATGTCGGG - Intronic
1091710682 12:2738018-2738040 CAGGCAGGCAGCAGCACTTCTGG - Intergenic
1105932980 13:25069584-25069606 CGGGCTCACCGCAGCCCGGCCGG + Intergenic
1107534234 13:41311910-41311932 CGGGCTCGCAGCAGCCCCTCAGG + Intronic
1110558361 13:76885586-76885608 CTGGCTAGCCGCAGTCCGTCCGG - Exonic
1113671221 13:112176726-112176748 CGGGATAGCGGCAGCACCTCGGG + Intergenic
1113758509 13:112831349-112831371 CGGGCAGGGCACAGCAAGTCAGG - Intronic
1115606666 14:35009888-35009910 CAGGCTGGGCGCACCACGTTGGG + Intronic
1121857553 14:97283953-97283975 TGGGCTGGAGGCAGCATGTCAGG - Intergenic
1122736684 14:103847565-103847587 CGGGCGGGCCGCAGGCTGTCGGG - Exonic
1133369897 16:5239597-5239619 CGGCCTGGCCGGAGCGGGTCTGG + Intergenic
1135546809 16:23371959-23371981 AGAGCTGGCCCCAGCAAGTCTGG + Intronic
1136511022 16:30738411-30738433 CCGTCTGTCCGCAGCATGTCAGG + Exonic
1142007798 16:87697995-87698017 CGGGCTGGCCCCAAGACGACCGG - Exonic
1142031262 16:87839647-87839669 CGGGCTGGCCACAGCCTCTCAGG + Intronic
1142352562 16:89586848-89586870 CTGGTGGGCCCCAGCACGTCTGG + Intronic
1145037541 17:19551828-19551850 CAGGCTGGGGGCAGCTCGTCTGG + Intronic
1146445347 17:32928258-32928280 CGGGCGGGCCGCGGCGAGTCGGG + Intronic
1146957225 17:36942718-36942740 CGGGGAGGGCGCAGGACGTCAGG - Intronic
1149470897 17:56914230-56914252 CGGGCTGGGCGCGGGACGCCGGG + Intergenic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1157535604 18:48455292-48455314 AGGGCTGGGCACAGCACTTCGGG - Intergenic
1160204684 18:76822814-76822836 CGGGCGGGCCGCAGCGCGGGCGG + Intronic
1160223000 18:76990839-76990861 CGGGCTGGCAGCAGCGGGTTTGG + Intronic
1161738636 19:6007014-6007036 GGGACCGGCCTCAGCACGTCGGG + Exonic
1162932775 19:13965628-13965650 GGGATGGGCCGCAGCACGTCGGG + Exonic
1164402538 19:27911684-27911706 CAAGCTGGCCCCAGCACGCCGGG + Intergenic
1164853147 19:31501067-31501089 CGCCCTGGCCGCAGCACTCCTGG + Intergenic
932735217 2:74249656-74249678 AGGGCAGGGAGCAGCACGTCAGG + Intronic
934636305 2:95992420-95992442 CAGCCTGGCCGCGGCAAGTCAGG - Intergenic
934797338 2:97113006-97113028 CAGCCTGGCCGCGGCAAGTCAGG + Intergenic
934836067 2:97590433-97590455 CAGCCTGGCCGCGGCAAGTCAGG - Intergenic
936273436 2:111069959-111069981 AGGGCTGGCTGCAGCACCTGTGG - Intronic
937424761 2:121789702-121789724 TGGGCTGGTTGCAGCAGGTCTGG + Intergenic
948994430 2:241571291-241571313 CGGTCTGGCCGGAGCAGGGCAGG - Intronic
1174284241 20:49461089-49461111 TGGGCTGGCAGCAGAACGTGGGG - Intronic
1176102982 20:63372903-63372925 CTGCCTGGCCCCAGCACATCTGG + Intronic
1176136913 20:63527341-63527363 CAGGCTGGGCGCAGCAGCTCAGG + Intergenic
1176172338 20:63701637-63701659 AGGGCTGGCAGCAGCAGGTCTGG + Intronic
1180160899 21:45998257-45998279 CGGGCTGGCCCCAGGACCGCCGG + Intronic
1180217507 21:46334930-46334952 CGTGCAGGCGGCAGCACGTGGGG - Intronic
1181554213 22:23658377-23658399 CGGGCTGGGCGCAGTGGGTCAGG - Intergenic
1183037108 22:35148819-35148841 CTGGCTTGCCCCAGCAGGTCTGG - Intergenic
1183037404 22:35150643-35150665 CTGGCTTGCCCCAGCAGGTCTGG + Intergenic
1184721388 22:46316112-46316134 AGAGCTGGCCGCAGCATGGCGGG - Exonic
1185182386 22:49370942-49370964 CGGGCTGTCGGTAGCCCGTCAGG - Intergenic
950286807 3:11751511-11751533 AGGCCTGGCCCCAGCACGGCAGG - Intergenic
954035340 3:47848237-47848259 CGGGCGGGCCGCTGCCAGTCCGG + Exonic
961532552 3:127548036-127548058 TGGGGGGGCCGCAGAACGTCGGG + Intergenic
968085127 3:195870747-195870769 TGGGCTGGCCACAGCATGCCAGG + Intronic
968916155 4:3497857-3497879 AGGGCTGGCCCCACCACCTCTGG - Intronic
969652482 4:8475951-8475973 CGGGGTGGCCGCAGCTCCGCAGG - Exonic
978080215 4:104582004-104582026 CGGGCTGCCCGCGGCACTTGCGG + Intergenic
983939817 4:173527298-173527320 CGGGCTGGCCGCAGCACGTCTGG - Exonic
999730827 5:154475827-154475849 CCGGCTGGCCGCAGCAAGTCTGG - Exonic
1002000068 5:176192365-176192387 CGAGCTGGCCCCAGCTCCTCTGG + Intergenic
1002033389 5:176447447-176447469 AGGGGCGGCGGCAGCACGTCAGG + Intergenic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1002913645 6:1510801-1510823 CAGGCTGGCCCCAGCACATTAGG - Intergenic
1008508418 6:52253640-52253662 CGGGCTGGCAGCAACTCCTCAGG + Intergenic
1013130890 6:107231700-107231722 CTGGCTGGGCGCAGCACTTTGGG + Intronic
1018703319 6:166445240-166445262 GGGGCTGCCCGCAGCACGTGGGG + Intronic
1019329468 7:455488-455510 TGGGCTGGACGCAGGACGTGGGG + Intergenic
1019520489 7:1458683-1458705 CCGGCTGGCAGCAGCACCTGGGG + Intronic
1019720231 7:2565374-2565396 CAGGCTGGAGGCAGCACGGCTGG + Intronic
1029655682 7:101922851-101922873 TGGGCTGGCCACAGCATGTCAGG + Intronic
1049574678 8:143384689-143384711 CTGGCTGGCAGCAGGACCTCAGG - Intergenic
1058053346 9:100427411-100427433 CGGGCGGGCCGCAGCCGGGCGGG + Intronic
1058486317 9:105446505-105446527 CAGGCTTGCAGCACCACGTCTGG + Intergenic
1058908154 9:109498054-109498076 CGGGATCCCCGCACCACGTCGGG - Intronic
1058956935 9:109957879-109957901 AGGGCTGGCCGCAGTGAGTCCGG + Intronic
1187281269 X:17860434-17860456 CGGGGTGGCCGCACCAGCTCGGG - Intronic
1187366044 X:18666616-18666638 CGGGCTGGCCACGGCAAGTGTGG + Intronic
1197108361 X:122742926-122742948 CAGGCTGGGCACAGCACGTTGGG - Intergenic