ID: 983941535

View in Genome Browser
Species Human (GRCh38)
Location 4:173538445-173538467
Sequence GTGGACCCCCAGCTCCGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983941522_983941535 24 Left 983941522 4:173538398-173538420 CCGGTTCTCCGCCGCTCAGGCTG No data
Right 983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG No data
983941527_983941535 13 Left 983941527 4:173538409-173538431 CCGCTCAGGCTGGGAGAGGTCAC No data
Right 983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG No data
983941533_983941535 -9 Left 983941533 4:173538431-173538453 CCGCTCCGGGCAGGGTGGACCCC No data
Right 983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG No data
983941526_983941535 16 Left 983941526 4:173538406-173538428 CCGCCGCTCAGGCTGGGAGAGGT No data
Right 983941535 4:173538445-173538467 GTGGACCCCCAGCTCCGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983941535 Original CRISPR GTGGACCCCCAGCTCCGTCT CGG Intergenic
No off target data available for this crispr