ID: 983944125

View in Genome Browser
Species Human (GRCh38)
Location 4:173567348-173567370
Sequence GAGCAGGGTTTTTCAATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983944125_983944127 -8 Left 983944125 4:173567348-173567370 CCAGAGATTGAAAAACCCTGCTC No data
Right 983944127 4:173567363-173567385 CCCTGCTCTAGACCATGCTTTGG No data
983944125_983944129 -7 Left 983944125 4:173567348-173567370 CCAGAGATTGAAAAACCCTGCTC No data
Right 983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983944125 Original CRISPR GAGCAGGGTTTTTCAATCTC TGG (reversed) Intergenic
No off target data available for this crispr