ID: 983944129

View in Genome Browser
Species Human (GRCh38)
Location 4:173567364-173567386
Sequence CCTGCTCTAGACCATGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983944125_983944129 -7 Left 983944125 4:173567348-173567370 CCAGAGATTGAAAAACCCTGCTC No data
Right 983944129 4:173567364-173567386 CCTGCTCTAGACCATGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983944129 Original CRISPR CCTGCTCTAGACCATGCTTT GGG Intergenic
No off target data available for this crispr