ID: 983944932

View in Genome Browser
Species Human (GRCh38)
Location 4:173575597-173575619
Sequence GGGACCAGAATAATCTATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983944932_983944937 25 Left 983944932 4:173575597-173575619 CCAGGATAGATTATTCTGGTCCC No data
Right 983944937 4:173575645-173575667 ATTGGAGTTAAGTAAAACCCAGG No data
983944932_983944935 7 Left 983944932 4:173575597-173575619 CCAGGATAGATTATTCTGGTCCC No data
Right 983944935 4:173575627-173575649 GCCACATCTCTCTCTATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983944932 Original CRISPR GGGACCAGAATAATCTATCC TGG (reversed) Intergenic
No off target data available for this crispr