ID: 983945850

View in Genome Browser
Species Human (GRCh38)
Location 4:173584692-173584714
Sequence AGCGCCTCATACACCCGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983945849_983945850 -8 Left 983945849 4:173584677-173584699 CCTTAGCTTATCTTTAGCGCCTC No data
Right 983945850 4:173584692-173584714 AGCGCCTCATACACCCGTTCTGG No data
983945846_983945850 20 Left 983945846 4:173584649-173584671 CCAGGAAGAGCGGAACACATATG No data
Right 983945850 4:173584692-173584714 AGCGCCTCATACACCCGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983945850 Original CRISPR AGCGCCTCATACACCCGTTC TGG Intergenic