ID: 983946798

View in Genome Browser
Species Human (GRCh38)
Location 4:173595169-173595191
Sequence CTATGTCACAATGAGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983946794_983946798 25 Left 983946794 4:173595121-173595143 CCGGGCCCGGCCAAAAATATATA No data
Right 983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG No data
983946795_983946798 20 Left 983946795 4:173595126-173595148 CCCGGCCAAAAATATATATTTAA No data
Right 983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG No data
983946796_983946798 19 Left 983946796 4:173595127-173595149 CCGGCCAAAAATATATATTTAAA No data
Right 983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG No data
983946793_983946798 28 Left 983946793 4:173595118-173595140 CCACCGGGCCCGGCCAAAAATAT No data
Right 983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG No data
983946797_983946798 15 Left 983946797 4:173595131-173595153 CCAAAAATATATATTTAAAAATA No data
Right 983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983946798 Original CRISPR CTATGTCACAATGAGAAAGT TGG Intergenic
No off target data available for this crispr