ID: 983951896

View in Genome Browser
Species Human (GRCh38)
Location 4:173652466-173652488
Sequence AAGGCCTCGGGAATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983951890_983951896 6 Left 983951890 4:173652437-173652459 CCAGAGAATACTGATGTTCTCCT No data
Right 983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG No data
983951886_983951896 28 Left 983951886 4:173652415-173652437 CCCTTCCAACTGACGTGCATGCC No data
Right 983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG No data
983951888_983951896 23 Left 983951888 4:173652420-173652442 CCAACTGACGTGCATGCCCAGAG No data
Right 983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG No data
983951889_983951896 7 Left 983951889 4:173652436-173652458 CCCAGAGAATACTGATGTTCTCC No data
Right 983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG No data
983951887_983951896 27 Left 983951887 4:173652416-173652438 CCTTCCAACTGACGTGCATGCCC No data
Right 983951896 4:173652466-173652488 AAGGCCTCGGGAATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983951896 Original CRISPR AAGGCCTCGGGAATGGATTT TGG Intergenic
No off target data available for this crispr