ID: 983952139

View in Genome Browser
Species Human (GRCh38)
Location 4:173654688-173654710
Sequence CACTGTCCACAAAGGAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983952139_983952146 17 Left 983952139 4:173654688-173654710 CCGACTCTCCTTTGTGGACAGTG No data
Right 983952146 4:173654728-173654750 TCTTCTTTTTTTCAACCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983952139 Original CRISPR CACTGTCCACAAAGGAGAGT CGG (reversed) Intergenic
No off target data available for this crispr