ID: 983956110

View in Genome Browser
Species Human (GRCh38)
Location 4:173700560-173700582
Sequence GCAAACAAAACAATAATGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983956108_983956110 21 Left 983956108 4:173700516-173700538 CCACTGTGCGAGGAGCTATATTC No data
Right 983956110 4:173700560-173700582 GCAAACAAAACAATAATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983956110 Original CRISPR GCAAACAAAACAATAATGAA AGG Intergenic
No off target data available for this crispr