ID: 983959190

View in Genome Browser
Species Human (GRCh38)
Location 4:173732027-173732049
Sequence CCGTGCCAGGCCTGGGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983959190_983959205 21 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959205 4:173732071-173732093 GCAGTTTGGGAGGCCTAGGTGGG 0: 16
1: 2157
2: 77343
3: 260965
4: 251776
983959190_983959206 24 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959206 4:173732074-173732096 GTTTGGGAGGCCTAGGTGGGAGG 0: 13
1: 1714
2: 56869
3: 144472
4: 190857
983959190_983959197 7 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959197 4:173732057-173732079 CACCTGTAATCCCAGCAGTTTGG 0: 981
1: 76445
2: 215811
3: 288052
4: 255678
983959190_983959202 17 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959202 4:173732067-173732089 CCCAGCAGTTTGGGAGGCCTAGG 0: 36
1: 5586
2: 215498
3: 268513
4: 187551
983959190_983959204 20 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959204 4:173732070-173732092 AGCAGTTTGGGAGGCCTAGGTGG 0: 28
1: 4116
2: 158883
3: 183576
4: 112806
983959190_983959200 11 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959200 4:173732061-173732083 TGTAATCCCAGCAGTTTGGGAGG 0: 3819
1: 309289
2: 271603
3: 206826
4: 226724
983959190_983959198 8 Left 983959190 4:173732027-173732049 CCCTGATCCCAGGCCTGGCACGG No data
Right 983959198 4:173732058-173732080 ACCTGTAATCCCAGCAGTTTGGG 0: 1062
1: 81056
2: 318220
3: 267495
4: 239886

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983959190 Original CRISPR CCGTGCCAGGCCTGGGATCA GGG (reversed) Intergenic
No off target data available for this crispr