ID: 983964455

View in Genome Browser
Species Human (GRCh38)
Location 4:173792461-173792483
Sequence CTGTGGGCTTTGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983964443_983964455 25 Left 983964443 4:173792413-173792435 CCTCAAGCCTAGTTAGATCCATA No data
Right 983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG No data
983964445_983964455 18 Left 983964445 4:173792420-173792442 CCTAGTTAGATCCATAGGATTTG No data
Right 983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG No data
983964447_983964455 7 Left 983964447 4:173792431-173792453 CCATAGGATTTGGAAAAACCACA No data
Right 983964455 4:173792461-173792483 CTGTGGGCTTTGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983964455 Original CRISPR CTGTGGGCTTTGAGGGCAGA GGG Intergenic
No off target data available for this crispr