ID: 983968318

View in Genome Browser
Species Human (GRCh38)
Location 4:173841869-173841891
Sequence TAGTTGCCATAGGCACCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983968318_983968320 7 Left 983968318 4:173841869-173841891 CCACGTGGTGCCTATGGCAACTA No data
Right 983968320 4:173841899-173841921 TTGCTGCTGCAATACAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983968318 Original CRISPR TAGTTGCCATAGGCACCACG TGG (reversed) Intergenic
No off target data available for this crispr