ID: 983973470

View in Genome Browser
Species Human (GRCh38)
Location 4:173902535-173902557
Sequence GTTTCGTTTTGTTTAGTGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983973469_983973470 5 Left 983973469 4:173902507-173902529 CCAGGGTTGAGAAGTGGCAATCT No data
Right 983973470 4:173902535-173902557 GTTTCGTTTTGTTTAGTGACCGG No data
983973464_983973470 30 Left 983973464 4:173902482-173902504 CCTGAGACCTACTGAGTAAAAGT No data
Right 983973470 4:173902535-173902557 GTTTCGTTTTGTTTAGTGACCGG No data
983973465_983973470 23 Left 983973465 4:173902489-173902511 CCTACTGAGTAAAAGTTTCCAGG No data
Right 983973470 4:173902535-173902557 GTTTCGTTTTGTTTAGTGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983973470 Original CRISPR GTTTCGTTTTGTTTAGTGAC CGG Intergenic