ID: 983984505

View in Genome Browser
Species Human (GRCh38)
Location 4:174041887-174041909
Sequence CCACCCTTCATAGGTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983984505_983984508 8 Left 983984505 4:174041887-174041909 CCTCTTTTACCTATGAAGGGTGG No data
Right 983984508 4:174041918-174041940 CTTAGCTGCTGTGCAAAACAAGG No data
983984505_983984511 26 Left 983984505 4:174041887-174041909 CCTCTTTTACCTATGAAGGGTGG No data
Right 983984511 4:174041936-174041958 CAAGGCCCTGCAGGGAGCCCTGG No data
983984505_983984509 17 Left 983984505 4:174041887-174041909 CCTCTTTTACCTATGAAGGGTGG No data
Right 983984509 4:174041927-174041949 TGTGCAAAACAAGGCCCTGCAGG No data
983984505_983984510 18 Left 983984505 4:174041887-174041909 CCTCTTTTACCTATGAAGGGTGG No data
Right 983984510 4:174041928-174041950 GTGCAAAACAAGGCCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983984505 Original CRISPR CCACCCTTCATAGGTAAAAG AGG (reversed) Intergenic
No off target data available for this crispr