ID: 983985267

View in Genome Browser
Species Human (GRCh38)
Location 4:174052233-174052255
Sequence AAGGAGTTATGAGTGGGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983985267_983985273 12 Left 983985267 4:174052233-174052255 CCATGACCCACTCATAACTCCTT No data
Right 983985273 4:174052268-174052290 TGTGTTAACAGTTTTACTCTTGG No data
983985267_983985274 30 Left 983985267 4:174052233-174052255 CCATGACCCACTCATAACTCCTT No data
Right 983985274 4:174052286-174052308 CTTGGCATGTGCAGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983985267 Original CRISPR AAGGAGTTATGAGTGGGTCA TGG (reversed) Intergenic
No off target data available for this crispr