ID: 983986327

View in Genome Browser
Species Human (GRCh38)
Location 4:174064357-174064379
Sequence GGATAATCACACTTGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983986323_983986327 14 Left 983986323 4:174064320-174064342 CCTATCTGAACATCAGATTCTCC No data
Right 983986327 4:174064357-174064379 GGATAATCACACTTGCTGGCTGG No data
983986325_983986327 -7 Left 983986325 4:174064341-174064363 CCATTTGTAACATGACGGATAAT No data
Right 983986327 4:174064357-174064379 GGATAATCACACTTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983986327 Original CRISPR GGATAATCACACTTGCTGGC TGG Intergenic
No off target data available for this crispr