ID: 983989579

View in Genome Browser
Species Human (GRCh38)
Location 4:174101367-174101389
Sequence TTTGTCAAGGCCACAGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983989579_983989583 -6 Left 983989579 4:174101367-174101389 CCAATACCTGTGGCCTTGACAAA No data
Right 983989583 4:174101384-174101406 GACAAACCAGGTCATGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983989579 Original CRISPR TTTGTCAAGGCCACAGGTAT TGG (reversed) Intergenic
No off target data available for this crispr