ID: 983989971

View in Genome Browser
Species Human (GRCh38)
Location 4:174106756-174106778
Sequence GTGAAGACTGCCCTCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983989971_983989978 2 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989978 4:174106781-174106803 CATGAGGCAGTGATGGGCTTGGG No data
983989971_983989977 1 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989977 4:174106780-174106802 GCATGAGGCAGTGATGGGCTTGG No data
983989971_983989983 29 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989983 4:174106808-174106830 CCGCAGCTACTGGGGAGCAATGG No data
983989971_983989979 19 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989979 4:174106798-174106820 CTTGGGCTGACCGCAGCTACTGG No data
983989971_983989984 30 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989984 4:174106809-174106831 CGCAGCTACTGGGGAGCAATGGG No data
983989971_983989975 -5 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989975 4:174106774-174106796 TTCACGGCATGAGGCAGTGATGG No data
983989971_983989981 21 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989981 4:174106800-174106822 TGGGCTGACCGCAGCTACTGGGG No data
983989971_983989980 20 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989980 4:174106799-174106821 TTGGGCTGACCGCAGCTACTGGG No data
983989971_983989976 -4 Left 983989971 4:174106756-174106778 CCACCTGGGAGGGCAGTCTTCAC No data
Right 983989976 4:174106775-174106797 TCACGGCATGAGGCAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983989971 Original CRISPR GTGAAGACTGCCCTCCCAGG TGG (reversed) Intergenic