ID: 983999102

View in Genome Browser
Species Human (GRCh38)
Location 4:174218483-174218505
Sequence CTGTCTTCCGACTGCCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
983999102_983999105 27 Left 983999102 4:174218483-174218505 CCAGCCTGGCAGTCGGAAGACAG No data
Right 983999105 4:174218533-174218555 TTAAGTGCTTCCTAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
983999102 Original CRISPR CTGTCTTCCGACTGCCAGGC TGG (reversed) Intergenic
No off target data available for this crispr