ID: 984002484

View in Genome Browser
Species Human (GRCh38)
Location 4:174267296-174267318
Sequence CTCAGCTTCTCGAAAAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 5, 3: 57, 4: 231}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984002484_984002489 19 Left 984002484 4:174267296-174267318 CCAGCACTTTTCGAGAAGCTGAG 0: 1
1: 0
2: 5
3: 57
4: 231
Right 984002489 4:174267338-174267360 CCAAGAGTTCAAGACCAGACTGG 0: 31
1: 1891
2: 26047
3: 101939
4: 172231
984002484_984002490 20 Left 984002484 4:174267296-174267318 CCAGCACTTTTCGAGAAGCTGAG 0: 1
1: 0
2: 5
3: 57
4: 231
Right 984002490 4:174267339-174267361 CAAGAGTTCAAGACCAGACTGGG 0: 29
1: 1948
2: 23292
3: 43009
4: 60539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984002484 Original CRISPR CTCAGCTTCTCGAAAAGTGC TGG (reversed) Intronic
900728173 1:4232415-4232437 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
900838121 1:5022285-5022307 CTCAGCTGATAGAAAAATGCAGG - Intergenic
901085714 1:6611060-6611082 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
901482025 1:9531773-9531795 CTCAGCTTCCCAAAGTGTGCTGG + Intergenic
901569392 1:10147239-10147261 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
902919715 1:19658486-19658508 CCCAGGTTCTCCAGAAGTGCCGG + Intergenic
903414961 1:23176311-23176333 CTCAGCCTCCCCAAAAGTGCTGG + Intronic
903613947 1:24638405-24638427 CTCAGGCTCTCAAAAAGTGCTGG - Intronic
904124169 1:28224631-28224653 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
904313749 1:29646492-29646514 CTGAGCTTCTGGAAAGGAGCAGG - Intergenic
904345843 1:29868639-29868661 CTCAGCTTCATGAAAAATGGTGG - Intergenic
904690346 1:32289091-32289113 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
904963040 1:34349628-34349650 CTCTTCCTCTCCAAAAGTGCTGG + Intergenic
906397542 1:45480071-45480093 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
906490134 1:46261876-46261898 CTCAGCCTCTCAAAAAGTGCTGG - Intronic
906628210 1:47343100-47343122 CTCAGCTACTCGGGAAGTGGAGG - Intronic
907215704 1:52861957-52861979 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
910682163 1:89877947-89877969 CTCAGCTTCTATAAAAGGGAAGG - Intronic
912458206 1:109813505-109813527 CTCAGCTTCCCAAAAACTGTTGG + Intergenic
912647898 1:111412488-111412510 CTCAGCTTTTCCAGAAGAGCTGG - Intergenic
913280448 1:117180555-117180577 CTCAGCTTTTCTAACAGTACAGG - Intronic
914685628 1:149976358-149976380 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
914858297 1:151367738-151367760 CTCAGCCTCTTGAGAAGTGGGGG + Intronic
915029930 1:152870467-152870489 TTAAGCTCCTCGAAGAGTGCTGG - Intergenic
916401713 1:164456389-164456411 CTTGGCTTCTCCCAAAGTGCTGG - Intergenic
917102371 1:171459302-171459324 CTCAGCCTCTCAAAAAGAGCTGG - Intergenic
919002183 1:191847063-191847085 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
920535978 1:206736907-206736929 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
922298596 1:224274383-224274405 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
923662391 1:235969504-235969526 CTCAACCTCTCAAAAAGTGCTGG - Intergenic
923987547 1:239398485-239398507 CTCGGCCTCCCAAAAAGTGCTGG + Intronic
1063420053 10:5905265-5905287 CTCGGCCTCCCGCAAAGTGCTGG - Intronic
1063431224 10:5990165-5990187 CTCAGCCTCCCAAAAAGTGTTGG + Intergenic
1064211030 10:13360582-13360604 CCCAGCCTCTCAAAAAGTGCTGG - Intergenic
1065667822 10:28082001-28082023 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1068132054 10:52907215-52907237 CTCAGCCTCTATTAAAGTGCTGG + Intergenic
1069534881 10:69245937-69245959 CCCTCCTTCTCGCAAAGTGCTGG - Intronic
1070107725 10:73451651-73451673 CTCAGCCTCTCAAAAAGCGCTGG - Intronic
1071234855 10:83633328-83633350 CCCAGCTTCTACAAGAGTGCTGG - Intergenic
1071498783 10:86189119-86189141 CTCCCCTTCTCTAAAAGTGGGGG + Intronic
1073144492 10:101271669-101271691 CTCAGCCTCCCAAAAAGTGTTGG + Intergenic
1073358049 10:102872474-102872496 CTGAGCATCTAGAAAACTGCTGG + Exonic
1075071331 10:119321744-119321766 CTCAGCTTCCAGAATAGGGCAGG - Intronic
1080336784 11:31206662-31206684 CTCAGTCCCTCCAAAAGTGCTGG + Intronic
1083246427 11:61431420-61431442 CTCAGCTTTCCAAAAAGTGCTGG + Intronic
1090303362 11:125667870-125667892 ATCAGCCTCCCAAAAAGTGCTGG + Intronic
1092630839 12:10374626-10374648 CTCAGGTCCTCCCAAAGTGCTGG + Intronic
1093429157 12:19064357-19064379 CTCGGCCTCCCAAAAAGTGCTGG + Intergenic
1093647092 12:21599379-21599401 CTGAGGATCTAGAAAAGTGCTGG - Intronic
1094291984 12:28861335-28861357 CTCAGCCTCACCCAAAGTGCTGG + Intergenic
1096532097 12:52248671-52248693 CTGAGCTTCTCCAGCAGTGCGGG + Exonic
1096705467 12:53418809-53418831 CTCGGCCTCTCTCAAAGTGCTGG + Intergenic
1099134720 12:78881802-78881824 ATCAGCTTCTCAAAGAGAGCTGG - Intronic
1099798754 12:87430762-87430784 TTCAGCTTCTGGAAATTTGCAGG + Intergenic
1100190923 12:92190822-92190844 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1100592451 12:96042252-96042274 CTCAGCCTCCCAGAAAGTGCTGG + Intronic
1100769044 12:97900972-97900994 CTTGGCTTCCCCAAAAGTGCTGG + Intergenic
1101992036 12:109494075-109494097 CTCAGCCTCTCAAAAAGTGCTGG + Intronic
1102378197 12:112440823-112440845 CTCAGCTCTTCCCAAAGTGCTGG + Intronic
1102876496 12:116453238-116453260 CTCAGATTCTAGAGAAGTGCTGG - Intergenic
1103371175 12:120420737-120420759 CTCAGCTACTCGGAAGGTGGAGG - Intergenic
1103545594 12:121698887-121698909 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1103866128 12:124053397-124053419 CTCAGCCTCTCCCAAAGTGCTGG - Intronic
1104297561 12:127531071-127531093 CCCAGCCTCCAGAAAAGTGCAGG - Intergenic
1104797681 12:131530872-131530894 CTCACCTCCTCCCAAAGTGCTGG - Intergenic
1105409307 13:20158087-20158109 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1106214645 13:27685292-27685314 CTCAGCCTCCCAAATAGTGCTGG + Intergenic
1107538190 13:41357067-41357089 CTCAGCATCCCCAAAAGTGTTGG - Intronic
1108309287 13:49170570-49170592 CTCAGCCCCTAGAATAGTGCTGG + Intronic
1108995739 13:56732246-56732268 CTCAGCCTCTCACAAAGTGTTGG - Intergenic
1109513523 13:63410122-63410144 CCCAGCTACTCCAGAAGTGCAGG + Intergenic
1110683765 13:78347561-78347583 CTCAGCTTCTCCAAATGTGAAGG - Intergenic
1110772215 13:79362671-79362693 CACAGATTCTCCAAAAGGGCTGG - Intronic
1112568762 13:100574321-100574343 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1113290140 13:108896715-108896737 CTCGGCCTCCCAAAAAGTGCTGG - Intronic
1120513090 14:85438896-85438918 CCCAGCTGCTAGAAATGTGCTGG + Intergenic
1121643772 14:95503732-95503754 CTCAGCTACTCGATAGGTGGAGG - Intergenic
1122948831 14:105029326-105029348 CTCAGCCTCCCAAAGAGTGCTGG + Intergenic
1123961101 15:25402135-25402157 CTCAGCTTCTTCAAATGTGCAGG - Intronic
1124414204 15:29461596-29461618 CTCAGCCTCTCGAGTAGTACAGG + Intronic
1125544729 15:40494721-40494743 CTCAGCTTCCCAGAAAGTGTTGG + Intergenic
1127877119 15:63121429-63121451 CTCAACTTCTGGAACAGCGCAGG - Intergenic
1128722806 15:69964526-69964548 CTCAGCCTCTTATAAAGTGCTGG - Intergenic
1128968441 15:72085274-72085296 CTCAGCTTCCCGAAAAGCGGGGG - Intronic
1129298566 15:74612894-74612916 CTCAGCTTCTCACTAAGGGCAGG - Intronic
1131511918 15:93053976-93053998 CTCGGCCTCCCAAAAAGTGCTGG - Intronic
1132276859 15:100574153-100574175 CTCAGCATTTTGAAAACTGCCGG - Exonic
1134158802 16:11867329-11867351 CTCGGCCTCCCAAAAAGTGCTGG + Intergenic
1134160058 16:11880575-11880597 CTCAGCTTTTCCGAAAGTGCAGG + Intronic
1134266096 16:12693952-12693974 CTCAGCCCCTCCTAAAGTGCTGG - Intronic
1134314747 16:13108242-13108264 CTCAGCTACTCGAAAAGGTGAGG - Intronic
1136182204 16:28561279-28561301 CTCAGCCTCCCAAAAAGTACTGG - Intronic
1136427305 16:30177532-30177554 TTCAGCTTTTCCCAAAGTGCTGG - Intergenic
1136864905 16:33740084-33740106 CTCAGCTACTCAAAAGGTTCAGG + Intergenic
1139676800 16:68529526-68529548 CTCGGCCTCTCAAAAAGTGTTGG + Intergenic
1140066507 16:71615833-71615855 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1140486344 16:75296598-75296620 CACAGCTTCTGGGAACGTGCAGG - Intronic
1141439470 16:84020395-84020417 CTCAGCCTCCCAAAAAATGCTGG + Intronic
1141854535 16:86672217-86672239 CTCATCTTCTGGAGAAGGGCCGG + Intergenic
1141985516 16:87577252-87577274 CTCTGCCTCCCGCAAAGTGCTGG + Intergenic
1203126403 16_KI270728v1_random:1588224-1588246 CTCAGCTACTCAAAAGGTTCAGG + Intergenic
1142729315 17:1840813-1840835 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1142730890 17:1856345-1856367 CTCAGCTTCCCCAAAAGTTTTGG - Intronic
1142886526 17:2915947-2915969 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1143064814 17:4238713-4238735 CTCAACCTCTCAAAAAGTGCTGG + Intronic
1143144077 17:4762340-4762362 CTCGGCCTCCCAAAAAGTGCTGG - Intergenic
1143154951 17:4830637-4830659 CTCGGCCTCCCCAAAAGTGCTGG + Intergenic
1143154996 17:4830941-4830963 CTCGGCCTCCCCAAAAGTGCTGG + Intergenic
1143825732 17:9605460-9605482 CTCAGCTCCCCACAAAGTGCTGG - Intronic
1146076023 17:29730067-29730089 CTCAGCCTCTCCCGAAGTGCTGG - Intronic
1147032621 17:37652325-37652347 CTCAGACTCTCGTCAAGTGCTGG - Intergenic
1147673812 17:42191707-42191729 CTCAGCCTCTCCCAAAGTGCTGG + Intronic
1148743721 17:49907230-49907252 CTCAGCTTCTGGAAGGGTGCAGG - Intergenic
1149149175 17:53538596-53538618 CTCAACTACTCCCAAAGTGCTGG + Intergenic
1149832376 17:59883517-59883539 CTCGGCCTCTCGCAAAGTGCTGG + Intronic
1150127379 17:62646712-62646734 CTCACCCTCTCCAAATGTGCTGG + Intronic
1150724288 17:67638857-67638879 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1150801129 17:68283567-68283589 CTCAGCTTCCCAAAGTGTGCTGG - Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152714705 17:81893123-81893145 CTCAGCTTCCCGAATAGAGCTGG + Intronic
1155029402 18:21971237-21971259 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1158919388 18:62173481-62173503 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1158946750 18:62453717-62453739 CTCAGCCTCCCGAAGTGTGCTGG - Intergenic
1159106129 18:64003200-64003222 CTCAGCATCAGGAACAGTGCTGG - Intronic
1159973927 18:74686945-74686967 CTCAGCAACTAGAAAAGTACGGG - Intronic
1160506836 18:79432127-79432149 GGCAGCTTCTCGAGAAGGGCAGG - Intronic
1161555409 19:4939309-4939331 CTCAGCCTCCCAAAAGGTGCTGG + Intronic
1161923871 19:7286637-7286659 CTCAGCTTCCTAAAAAGTCCAGG + Intronic
1162490489 19:10988354-10988376 CTCAGATGCTCCCAAAGTGCTGG + Intronic
1162938648 19:13995018-13995040 CTTAGCCTCCCAAAAAGTGCTGG + Intronic
1163081555 19:14947267-14947289 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
1163093498 19:15037880-15037902 CTCGGCTTCTCAAAGAGAGCTGG - Intergenic
1163740030 19:19005975-19005997 CTCAGCCTCCCAAAATGTGCTGG - Intronic
1165062659 19:33212427-33212449 CTCAGCTCCTCGAAGTGTCCTGG + Exonic
1165741702 19:38208733-38208755 CTCAGCCTCTCAAAAAGTGCTGG - Intergenic
1166596668 19:44056264-44056286 CTCAGCCTCCGAAAAAGTGCTGG - Intronic
1167417452 19:49383288-49383310 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1167500804 19:49846377-49846399 CCCAGCTACTCGACAAGTGGAGG - Intergenic
1167843741 19:52142695-52142717 CTCAGCCTCTCTCAATGTGCTGG - Intergenic
925580652 2:5406811-5406833 CTCGGCTTCACCAAATGTGCTGG - Intergenic
926996900 2:18745360-18745382 CTCAGCTTCTCAAAGTGCGCTGG + Intergenic
927307513 2:21590523-21590545 CTCAGATTCTCTACAAGTGGAGG - Intergenic
928588357 2:32786388-32786410 CTCAGCCACTCAAAAAGTGCTGG + Intronic
929150662 2:38745401-38745423 CTCGGCCTCTCCCAAAGTGCTGG - Intronic
929749227 2:44692567-44692589 CTCAGCTTCTAGAACAGGCCTGG + Intronic
932234602 2:70110911-70110933 CTCAGCCTCTCAAAGTGTGCTGG - Intergenic
932600430 2:73120659-73120681 CTCAGCCTCCCAATAAGTGCTGG + Intronic
933851881 2:86374058-86374080 CTCAGCATGTAGAATAGTGCTGG - Intergenic
933919268 2:87028129-87028151 CTCAGCTGATGGAAAAATGCAGG + Intergenic
934003726 2:87741778-87741800 CTCAGCTGATGGAAAAATGCAGG - Intergenic
935464712 2:103382515-103382537 CTCGGCCTCCCAAAAAGTGCTGG + Intergenic
938891516 2:135710373-135710395 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
939266287 2:139877894-139877916 CTCAGCCTCCCACAAAGTGCTGG - Intergenic
941955427 2:171199394-171199416 CTCAGCTTCCCCAAAAGTGCTGG - Intronic
942731989 2:179070379-179070401 CTCAGCTTCTCTATAAGAACTGG + Intergenic
945462616 2:210127545-210127567 CTTGGCCTCTCAAAAAGTGCTGG - Intronic
946412261 2:219521310-219521332 CTCAGCTTCTCAGACACTGCCGG + Intronic
946833808 2:223751590-223751612 CTCAGCCTCCCAAAAAGTTCTGG - Intergenic
947080006 2:226385625-226385647 CTTAACATCTAGAAAAGTGCTGG + Intergenic
947601454 2:231453265-231453287 CTCAGCTTCCTGAGAACTGCAGG + Intergenic
948446102 2:238034173-238034195 CTCAGCGCCTCCTAAAGTGCTGG - Intronic
948779092 2:240306197-240306219 CTCAGCCTCCCAAAAAGTGCTGG + Intergenic
1169485150 20:6024066-6024088 CTCAGCTACTCAAGAAGCGCAGG - Intronic
1171252989 20:23663488-23663510 CTCAGCTTGTTGGAAAGTCCCGG - Intergenic
1172102975 20:32496798-32496820 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1172653694 20:36523908-36523930 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1174522260 20:51140897-51140919 CTCACCTTGTGGAAAAGAGCCGG - Intergenic
1177159792 21:17535447-17535469 CTCAGCGCCTCCGAAAGTGCTGG + Intronic
1178661264 21:34509704-34509726 CTCGGCCTCTCCCAAAGTGCTGG + Intergenic
1180676250 22:17588411-17588433 CTCAGGTGATCCAAAAGTGCTGG - Intronic
1180975134 22:19844037-19844059 CTCAGTCTCTGGAGAAGTGCTGG - Intronic
1181548799 22:23623153-23623175 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1182232931 22:28852531-28852553 CTCAGCCTCTTCCAAAGTGCTGG - Intergenic
1184225325 22:43126434-43126456 CTCGGCCTCCCAAAAAGTGCTGG + Intronic
1185230078 22:49674967-49674989 CTCAGCCCCTTGTAAAGTGCTGG - Intergenic
949229259 3:1731068-1731090 CACAGCTCCTAGAACAGTGCCGG + Intergenic
949984631 3:9530846-9530868 CTCAGCCTCCTGCAAAGTGCTGG + Intronic
950024997 3:9814046-9814068 CTCGGCCTCCCAAAAAGTGCTGG - Intronic
952405386 3:33000188-33000210 ATCAGCCTCCCAAAAAGTGCTGG + Intronic
953600693 3:44360855-44360877 CTCAGCCTCCCAAAAACTGCTGG + Intronic
954721934 3:52571769-52571791 CTCAGCCTCCCCGAAAGTGCTGG - Intronic
958150299 3:89684497-89684519 CTCGGCCTCCCAAAAAGTGCTGG + Intergenic
958754769 3:98237808-98237830 CTCAGCTCCTCCCATAGTGCTGG - Intergenic
959255001 3:103998572-103998594 CTCGGCCTCCCAAAAAGTGCTGG - Intergenic
964014752 3:151931052-151931074 CTCACCTTCGCCCAAAGTGCTGG + Intergenic
965748758 3:171954898-171954920 CTCAGATTCTCAAAATGAGCAGG - Intergenic
967073158 3:185979664-185979686 CCCAGCTTCTCGAAAGCTTCCGG - Intergenic
969660039 4:8522009-8522031 CTCAGCTTCTCGCTTGGTGCTGG + Intergenic
970205406 4:13650588-13650610 CTCAGCTACTCGGGAAGTGGAGG - Intergenic
971661665 4:29425815-29425837 CTCAGCTTCTGGAAATCTGATGG - Intergenic
972320528 4:37969594-37969616 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
972331058 4:38064872-38064894 CTCGGCCTCCCAAAAAGTGCTGG + Intronic
976268679 4:83208682-83208704 CTCAGCTTTTAGAACAGTGCTGG - Intergenic
977422365 4:96818292-96818314 CTCAGGTTCTGGAAAAATGCTGG + Intergenic
978838735 4:113184632-113184654 CTCAGCTACTGCAAAAGGGCTGG - Intronic
981333266 4:143537661-143537683 CTCAGCCTTCCAAAAAGTGCTGG - Intronic
981820010 4:148875525-148875547 CTCAGGTGCTCCCAAAGTGCTGG - Intergenic
982596633 4:157394042-157394064 CTCGGCCTCCCAAAAAGTGCTGG - Intergenic
983238385 4:165205860-165205882 CTCGGCCTCCCAAAAAGTGCTGG + Intronic
983289209 4:165780261-165780283 TTTAGCTTCTCCTAAAGTGCCGG + Intergenic
984002484 4:174267296-174267318 CTCAGCTTCTCGAAAAGTGCTGG - Intronic
984853231 4:184171813-184171835 CTCAGCATCTCGAATCGTGCCGG - Intronic
986894949 5:12354407-12354429 CTCAGCCGCCCAAAAAGTGCTGG - Intergenic
986895745 5:12365208-12365230 CTCAGCTTCTCAAGAAGGGAGGG - Intergenic
988101990 5:26691516-26691538 CTCAGCTTCTAATAAAGTGTGGG - Intergenic
988541194 5:32111636-32111658 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
991984758 5:72273260-72273282 CTCACTTTCTCGAAAAATCCCGG - Intronic
994093607 5:95829193-95829215 CTCATTTTCTCTAAAAGTGGTGG - Intergenic
994827925 5:104740032-104740054 CTCAGTGTCTCAAAAAATGCTGG - Intergenic
996445462 5:123544108-123544130 CTCTGCTAATAGAAAAGTGCAGG + Intronic
997887994 5:137648565-137648587 CCCAGCCTCAGGAAAAGTGCTGG + Intronic
999250861 5:150181526-150181548 CTCAGCCTCCCATAAAGTGCTGG + Intronic
1000106688 5:158066670-158066692 CTCAGCTTCTGGTGAAGTTCAGG + Intergenic
1000968898 5:167692210-167692232 CTCAGGGTCTAGAACAGTGCTGG + Intronic
1002212723 5:177608305-177608327 CTCACCTTCTCAAAAACGGCTGG - Intronic
1002339777 5:178507832-178507854 CTCAGCTTCTTGAGAACTGTGGG + Intronic
1002680225 5:180956002-180956024 CTCAGCCTCCCTAAAAGGGCTGG + Intergenic
1004296271 6:14414312-14414334 GTCAGCCTCTCCTAAAGTGCTGG - Intergenic
1004656375 6:17666074-17666096 CTCAGCCTCTCAAAGAGTGCTGG + Intronic
1005630214 6:27700258-27700280 CTCAGCCTCCCCTAAAGTGCTGG - Intergenic
1005965992 6:30726805-30726827 CTCAGCCTCCCAAAAAGTTCTGG + Intergenic
1006382914 6:33711261-33711283 CTCGGCCTCTCAAAGAGTGCTGG + Intronic
1007154189 6:39725730-39725752 CTCGGCTTCCCAAAAACTGCTGG - Intergenic
1007163263 6:39810105-39810127 ATAAGCTTCTCGGAAAGTCCTGG + Intronic
1011456397 6:87554849-87554871 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1011951976 6:92978186-92978208 CTCGGCCTCCCAAAAAGTGCTGG - Intergenic
1013545440 6:111152351-111152373 CTCAGCATCTAGAATAGTGCTGG + Intronic
1016932192 6:149422360-149422382 CTCAGCCTCCCGCAAAGTGCTGG + Intergenic
1018127510 6:160695942-160695964 CTCAGCTGATAGAAAAATGCAGG - Intergenic
1018149009 6:160921083-160921105 CTCAGCTGATAGAAAAATGCAGG + Intergenic
1020134913 7:5581784-5581806 CTCGGCCTCTCCCAAAGTGCTGG - Intergenic
1020239218 7:6379522-6379544 CTTAGCCTCTCAAAAAGTACTGG + Intronic
1025058832 7:55786839-55786861 TTCACCTTCTGGAAAAGGGCAGG - Intergenic
1026570323 7:71523623-71523645 TTCAGCTTCTCAAATAGTGGGGG - Intronic
1027281166 7:76610399-76610421 CTCAGCCTCCCAAAAAGTGCTGG - Intronic
1028651795 7:93158173-93158195 CTGAGCTTGTCAAAAAGTCCAGG - Intergenic
1029137030 7:98380682-98380704 CTCAGCCTCCTAAAAAGTGCTGG + Intronic
1029356527 7:100056188-100056210 CTCAGCACCTCCCAAAGTGCTGG + Intronic
1029461891 7:100699460-100699482 CTCAGCCTTTCCCAAAGTGCTGG - Intergenic
1029851773 7:103468824-103468846 CTCAGCCTCCTAAAAAGTGCTGG + Intergenic
1032597018 7:133251751-133251773 CTCTGCCTCTCAAAAAGTGTTGG + Intergenic
1033393401 7:140950215-140950237 CTCAGCCTCCCACAAAGTGCTGG - Intergenic
1036477627 8:9107932-9107954 CTTGGCCTCTCAAAAAGTGCTGG + Intronic
1037379592 8:18270459-18270481 CTCATCTTTACCAAAAGTGCTGG - Intergenic
1037920795 8:22804076-22804098 CTCGGCCTCCCAAAAAGTGCTGG - Intronic
1039475811 8:37838941-37838963 CTCAGCTCCTGGGAAAGGGCAGG - Exonic
1041553972 8:59132279-59132301 CTCAGCTTCTCGAAAGGCCGAGG - Intergenic
1042134400 8:65619283-65619305 CTCGGCCTCTCTATAAGTGCTGG - Intronic
1044012304 8:87009549-87009571 CTCAGCCTCTCAAAGTGTGCTGG + Intronic
1044931254 8:97253797-97253819 CTCACCTTCAGAAAAAGTGCTGG + Intergenic
1045576264 8:103423945-103423967 CTCAGCCTCCCAAAAAGTGTTGG + Intronic
1046439524 8:114239988-114240010 CTCAGCTTCTCAAAAAGTGTTGG - Intergenic
1046912924 8:119648267-119648289 CTCAGCATCTTCTAAAGTGCTGG + Intronic
1047006695 8:120627823-120627845 CTCAGCTTAGTGGAAAGTGCTGG + Intronic
1048493280 8:134914044-134914066 CTCAGCTTCACGAGAAGTAAGGG - Intergenic
1051950546 9:22626340-22626362 CTCAGCCTCCCAAAGAGTGCTGG - Intergenic
1052167131 9:25345538-25345560 CTCAGCTACTCCAAAAGTTGAGG + Intergenic
1052421748 9:28251302-28251324 CTCAGCTTCTAGAGAAGGGTAGG + Intronic
1053063247 9:35047679-35047701 CTCGGCCTCCCAAAAAGTGCTGG + Intergenic
1053147355 9:35720591-35720613 CTCAGCTTCTGGAAAATGGCTGG - Intronic
1056774588 9:89501641-89501663 AGCAGCTTCTAGAAAAGTCCGGG + Intergenic
1057365176 9:94413589-94413611 CTCAGCTTACTGCAAAGTGCTGG - Intronic
1057658148 9:96974504-96974526 CTCAGCTTACCGCAAAGTGCTGG + Intronic
1058512536 9:105735982-105736004 CTCAGCCTCTCAAAAATAGCTGG + Intronic
1058941145 9:109813771-109813793 ATCGGCTTCTTGAAAAGTCCAGG - Intronic
1059660258 9:116393129-116393151 ATCAGCTTCTCCAAAATTGTTGG - Intronic
1060975924 9:127764958-127764980 CTCAGCCTCCCAAAAAGTGCTGG + Intronic
1061533777 9:131235091-131235113 CTCTGCCTCTCGCAAAGAGCTGG + Intergenic
1061545971 9:131304381-131304403 CTCCGCCTCCCAAAAAGTGCTGG - Intronic
1061686655 9:132285931-132285953 CTCAGCCTCCCTCAAAGTGCTGG - Intronic
1061848145 9:133399624-133399646 CTCAGCCCCTCCCAAAGTGCTGG - Intronic
1062155865 9:135048197-135048219 TTCAGCCTCCCAAAAAGTGCTGG + Intergenic
1062561474 9:137144123-137144145 CTCAGCTTGTCCAAAGGTGGTGG + Intronic
1062713083 9:137987289-137987311 CTCAGCTCCTCGGGAAGTGGGGG + Intronic
1185686121 X:1930061-1930083 CTCAGCCTCCCCCAAAGTGCTGG - Intergenic
1187181562 X:16947322-16947344 CTCAGCTCCTCGCCCAGTGCTGG + Intronic
1187688629 X:21841167-21841189 CTCAGCCTCCCCCAAAGTGCTGG - Intronic
1190040395 X:47066721-47066743 CTCAGCCTCCCAAAAAGTGCTGG - Intergenic
1190657101 X:52622242-52622264 CTCAGCCTCTCAAAAAGTGTTGG + Intergenic
1190749175 X:53346091-53346113 CTCAGCCTCCCAAAAAGTACTGG - Intergenic
1192136084 X:68602157-68602179 CTCAGCCTCCCAAAAAGTGCAGG - Intergenic
1192338257 X:70239752-70239774 CTCAGTTTCCCCAAAAGTGAAGG - Exonic
1196620280 X:117814763-117814785 CTCAGACTCCCAAAAAGTGCTGG - Intergenic
1196705502 X:118713983-118714005 ATCAGCCTCCCAAAAAGTGCTGG - Intergenic
1197434507 X:126409700-126409722 CTCGGCCTCCCAAAAAGTGCTGG - Intergenic
1198282092 X:135152450-135152472 TTCAGCATCTAGAACAGTGCTGG + Intergenic
1198284395 X:135175437-135175459 TTCAGCATCTAGAACAGTGCTGG + Intergenic
1198286780 X:135198913-135198935 TTCAGCATCTAGAACAGTGCTGG + Intergenic
1198288867 X:135220072-135220094 TTCAGCATCTAGAACAGTGCTGG - Intergenic
1201854576 Y:18527538-18527560 CTCAGCTTTTCTTAAAGTTCTGG - Intergenic
1201878745 Y:18792847-18792869 CTCAGCTTTTCTTAAAGTTCTGG + Intronic
1202365445 Y:24159440-24159462 CTCAGCCTCCCAAACAGTGCTGG - Intergenic
1202505336 Y:25510682-25510704 CTCAGCCTCCCAAACAGTGCTGG + Intergenic
1202586954 Y:26440656-26440678 CTCAGCTACTCAAAAGGTTCAGG - Intergenic