ID: 984005387

View in Genome Browser
Species Human (GRCh38)
Location 4:174299879-174299901
Sequence ATGAAGAAACAGAATTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 1, 2: 2, 3: 75, 4: 631}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984005387_984005391 17 Left 984005387 4:174299879-174299901 CCTTCATAATTCTGTTTCTTCAT 0: 1
1: 1
2: 2
3: 75
4: 631
Right 984005391 4:174299919-174299941 TTTTATCATTGATTAATTGATGG No data
984005387_984005392 22 Left 984005387 4:174299879-174299901 CCTTCATAATTCTGTTTCTTCAT 0: 1
1: 1
2: 2
3: 75
4: 631
Right 984005392 4:174299924-174299946 TCATTGATTAATTGATGGATTGG 0: 1
1: 0
2: 7
3: 96
4: 466

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984005387 Original CRISPR ATGAAGAAACAGAATTATGA AGG (reversed) Intronic
901624002 1:10613254-10613276 ATAAAGAAACAGAGTCATGTTGG + Intronic
902914842 1:19631033-19631055 ATGAAGAAACAGTTTTTGGAAGG + Intronic
906336112 1:44932684-44932706 ATCAAGAATCAGAATGATGTTGG + Intronic
906938333 1:50234161-50234183 ATAAAGAAACAGAGTTTTAATGG - Intergenic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907000032 1:50843239-50843261 ATGAAGAAAAAGAATTAGGTCGG - Intronic
907352249 1:53841900-53841922 AGGAAAAAAAAGAATTTTGATGG + Intergenic
908563074 1:65326452-65326474 AGGAAGAAATAGAATGATAAAGG + Intronic
909040999 1:70651525-70651547 ATGAAGAAAAATATTTATGGAGG - Intergenic
909134846 1:71785257-71785279 AGGAAGAGACTGAATTATGCAGG - Intronic
909228350 1:73054838-73054860 ATGAGAAAACAGAATTAAGCAGG - Intergenic
909277766 1:73709800-73709822 ATGAAAGGACAGAACTATGAAGG + Intergenic
909346882 1:74600458-74600480 ATCAAGAAAAGGCATTATGAAGG + Intronic
910017422 1:82544379-82544401 ATGAAGAAACAGAACAAAGCTGG + Intergenic
910324108 1:85984677-85984699 AAGCAGAAATAGAAGTATGAAGG - Intronic
910485091 1:87704350-87704372 AGGAACAGACAGAATTATAATGG + Intergenic
911358025 1:96845441-96845463 GTAAAGAAAAAGAATTTTGATGG - Intergenic
912901875 1:113659952-113659974 AGCCAAAAACAGAATTATGAAGG + Intronic
913101357 1:115570542-115570564 AGGAAGAAAGAGCATAATGAAGG + Intergenic
913690503 1:121275480-121275502 TTTAAGAAACAGAATTCTCAAGG - Intronic
913691177 1:121281339-121281361 AAGAAGAAAGAGAATGAAGAAGG - Intronic
914146365 1:144998633-144998655 AAGAAGAAAGAGAATGAAGAAGG + Intronic
914147039 1:145004478-145004500 TTTAAGAAACAGAATTCTCAAGG + Intronic
914256436 1:145963819-145963841 ATGAGGAAACAGACTTAATAAGG + Intronic
914898585 1:151698455-151698477 GTGAAGAAACAGCAGTATGCTGG - Exonic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
915710021 1:157886968-157886990 ATGAAGAAACAAACTTATAATGG + Intronic
915790391 1:158663513-158663535 ATACAGAAACAGGATTTTGAAGG + Intronic
916449211 1:164903702-164903724 ATAAAGAAACAGAAGTTTAATGG - Intergenic
916849751 1:168691521-168691543 ATAAAGACACAGAATGCTGAGGG + Intergenic
916894276 1:169145757-169145779 AACAAGAAATAGAATTATGGAGG + Intronic
916943920 1:169704866-169704888 ATGAAGAAACTGAAGTTGGAGGG - Intronic
917225817 1:172781215-172781237 ACTATGCAACAGAATTATGAAGG + Intergenic
917644311 1:177014894-177014916 AGGAAGAAAGAGAAACATGAAGG + Intronic
918301771 1:183210789-183210811 ATGAAGAAACTGAACTTTCAGGG + Intronic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918602792 1:186383322-186383344 AGGAAGAAACAGATTTGGGATGG + Intronic
918943851 1:191034926-191034948 ATGGAGAATCAGATTTATGGAGG - Intergenic
919192157 1:194235603-194235625 ATGAAGAAACAGCATTGAGTTGG + Intergenic
919357497 1:196542929-196542951 ACCAAGATACAGAATTCTGAAGG + Intronic
920477821 1:206293969-206293991 TTTAAGAAACAGAATTCTCAAGG - Intronic
920478501 1:206299815-206299837 AAGAAGAAAGAGAATGAAGAAGG - Intronic
921107282 1:211995107-211995129 ATTAAGAATGAAAATTATGATGG - Intronic
921113661 1:212064991-212065013 AAGAAGAAACAGAATTCAAAAGG + Exonic
921253899 1:213322293-213322315 AAAAAGAAAAAAAATTATGAGGG + Intergenic
921258600 1:213365159-213365181 ATGCAGAACCAGTATTAAGACGG + Intergenic
921300628 1:213748336-213748358 ATGAAGGAGCAGATTTTTGAGGG + Intergenic
921310647 1:213839773-213839795 ATGAAGAAACTGAAGCATGGAGG - Intergenic
921557086 1:216611900-216611922 ATGAAGAAGCAGAAATATGGAGG + Intronic
921995841 1:221417175-221417197 ATGAAGAAAGAAAGTTATAATGG - Intergenic
922365536 1:224860040-224860062 AAAAAGAAACACAATTAAGAAGG - Intergenic
922405420 1:225307434-225307456 AGGAAGAAAAAGTATTAAGAAGG - Intronic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923377777 1:233382221-233382243 ATCAAGAAAAATAATTATGATGG - Intronic
923469912 1:234281238-234281260 ATGAAGACACAGAAGGGTGATGG + Intronic
923735558 1:236603720-236603742 ATGAAGAAACAAAATTAGAGAGG - Intronic
924054360 1:240111184-240111206 ATGAGGAAACAGGATTACCAGGG + Intronic
1063655503 10:7984237-7984259 ATGAATAAACAGTATTGTGCCGG - Intronic
1063861660 10:10315486-10315508 ATGAAAAGACACAATTATAAAGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1066546012 10:36501491-36501513 ATGAAGAAGCAGATATATAAGGG - Intergenic
1068324916 10:55472348-55472370 GTGAAGAAACATAATCATAATGG - Intronic
1068489846 10:57709441-57709463 ATGAAGAAAGTGAATTATCAAGG + Intergenic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1068950468 10:62771410-62771432 AAGAAGAAATCAAATTATGAGGG - Intergenic
1069385892 10:67883406-67883428 ATGAAGAAACAGCTTTAAGTTGG + Intergenic
1069509821 10:69033803-69033825 ATGAAGAAAGGGAAGTTTGAAGG - Intergenic
1072252753 10:93594581-93594603 ATTAATAAGCAGAATTAGGATGG - Intronic
1072297965 10:94029919-94029941 ATGTGGAAACACAATTATAAAGG - Intronic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1075503473 10:123000169-123000191 ATCAAGAAACAGAAGGATGCCGG + Intronic
1075937642 10:126356924-126356946 AGGAACAAACAGAAAAATGAAGG + Intronic
1076326922 10:129631360-129631382 ATGATGAGACAGAAGAATGAAGG + Intronic
1076348628 10:129799028-129799050 ATGATGAAACAAAATTCAGAAGG + Intergenic
1077897876 11:6467320-6467342 CTGAAGAAACAGCATGATAAAGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078707441 11:13758758-13758780 ATGAAGAAACAGAATCAAAGAGG + Intergenic
1078827199 11:14940538-14940560 ATATAGAAAGAGATTTATGAGGG + Intronic
1079675842 11:23225394-23225416 ATTAAGGAACAGAAATATGCAGG + Intergenic
1080340070 11:31251941-31251963 ATGAAGAAACCAAATCATGAAGG + Intronic
1080595106 11:33766054-33766076 ATGAAGAAACAGGATTAAAGAGG - Intronic
1080889554 11:36397754-36397776 ATGAAGGAAAAGAATTAAGAAGG - Intronic
1082125925 11:48430921-48430943 ATGAATGAATAGAATTATTAAGG - Intergenic
1082740065 11:56901008-56901030 ATGAAGAAACAGACTCACAAAGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083784897 11:64938752-64938774 ATAAAGAAACAGAATTGCAATGG + Intronic
1086378996 11:86232195-86232217 AGGAAGAAACAGATTTAATAAGG - Intergenic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087706648 11:101500756-101500778 ATGAGGAATCACATTTATGAAGG + Intronic
1088046969 11:105464758-105464780 ATGAAGATACAGTAGAATGAAGG + Intergenic
1088073821 11:105822345-105822367 TTGATTTAACAGAATTATGAGGG + Intronic
1088447302 11:109945868-109945890 ATGGAGAAACAGAAACATGGAGG - Intergenic
1089916956 11:122166173-122166195 AAGAAGAAACTGAATTAAGAGGG + Intergenic
1090125703 11:124081055-124081077 ATGAAGAAAAATAAACATGAGGG - Intergenic
1090432314 11:126656281-126656303 ATGAAGAAACTGAATCATGGAGG - Intronic
1090525502 11:127530295-127530317 TTGAAGAAAAAAAATTATGTTGG - Intergenic
1091033218 11:132210237-132210259 ATGAAGAAACAGAAGAGTGCTGG + Intronic
1091112825 11:132986371-132986393 GTGAAGAAACAGAATAATTAAGG + Intronic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091443661 12:530643-530665 ATGAAGAAACAGAAACAGAAAGG - Intronic
1091811180 12:3399122-3399144 ATGAAGCAACAGAAGTATGGTGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092075095 12:5666148-5666170 ATACAGAAACAGAATAGTGAAGG + Intronic
1092986511 12:13850880-13850902 ATGAAGAAAGAGAATCAGAAAGG - Intronic
1093051094 12:14505934-14505956 ATGAGGAAACAGAAACATGACGG + Intronic
1093364777 12:18280436-18280458 ATGATGAAAAAGAATTAGCAAGG + Intronic
1093916177 12:24804810-24804832 ATAAAGAAAAAGAATTTTAATGG + Intergenic
1093977842 12:25442100-25442122 ATGAAGGAGCAGGAATATGAGGG - Intronic
1094535602 12:31319999-31320021 AGGAAGAAACAGAATTTCTAAGG - Intronic
1094575229 12:31678896-31678918 ATGAGGAAACAGAATAATACAGG + Intronic
1094740667 12:33284745-33284767 TTGAAGGAACAAAATAATGAGGG + Intergenic
1094784668 12:33833555-33833577 ATGAAGATACAAATATATGATGG - Intergenic
1096479025 12:51925806-51925828 ATGCAGAAACAGACTTACAAGGG + Intergenic
1096983563 12:55742921-55742943 ATGAAGAGACAGAGATATGAGGG - Intergenic
1097901995 12:64882535-64882557 ATGAATACACAGCAGTATGAGGG - Intergenic
1098035193 12:66294519-66294541 ATGCTGAAACAGAAATATAAAGG + Intergenic
1098352366 12:69576977-69576999 ATGTGGAATAAGAATTATGATGG + Exonic
1098847262 12:75552961-75552983 ATGAAAAAACAGAATCAATATGG - Intergenic
1099602315 12:84756749-84756771 ATGAGGAAACTGGATGATGATGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1099892080 12:88602193-88602215 GGGAAGAAACAGAATGTTGATGG - Intergenic
1099917964 12:88919705-88919727 ATGAAAACACATAAATATGAGGG + Intergenic
1099936401 12:89130742-89130764 AGAAAGAAACAGAATTATTTTGG + Intergenic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100389774 12:94138325-94138347 ATGAAGAAACAGAAGTAAATCGG + Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1101358016 12:103998986-103999008 AAGAAAAAACAGTAGTATGATGG - Intronic
1101581728 12:106047922-106047944 ATGAGGGAACAGAAATAGGAAGG - Intergenic
1102086297 12:110143180-110143202 ATGAAGAAACATAATTTACATGG - Intronic
1102871878 12:116420141-116420163 AGGAAGAAAAAGAAAAATGAGGG + Intergenic
1104513593 12:129403767-129403789 AAGAAGAAAGGGAATAATGAGGG + Intronic
1105365647 13:19761921-19761943 CTTCAGAAACAGAATTAAGAGGG + Intronic
1105386897 13:19938676-19938698 ATGAAGAAACTGAAATGTTAGGG + Intergenic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1105717140 13:23078374-23078396 ATGAAGAAACACAATTGAGAGGG - Intergenic
1105832555 13:24177128-24177150 ATTAAGAAACAGAATTGACAAGG - Intronic
1106200454 13:27532418-27532440 ATGAAGAAACAGAATTAGCGAGG - Intergenic
1107025958 13:35801774-35801796 GTAAAGAAACAAAATTAAGAAGG - Intronic
1107326984 13:39254886-39254908 ATGAAAAAACAGCAGTAAGAGGG - Intergenic
1107702683 13:43063817-43063839 AAGAATAAACAAAATTATAAGGG + Intronic
1108101790 13:46964814-46964836 ATGAAGACACAGAATAAAGAGGG - Intergenic
1108332126 13:49397859-49397881 TTTAAAAAACAGAATTATCAAGG + Intronic
1108420610 13:50245311-50245333 ATGAAGAAGCAGAATTAGAGAGG - Intronic
1109102237 13:58199773-58199795 ATGAAGAAAAAGAAGTTTAATGG - Intergenic
1109957472 13:69587080-69587102 TTGAAGAAAGAGAACTATAAAGG + Intergenic
1110012331 13:70352849-70352871 ATGAGGATACAAAATGATGAGGG - Intergenic
1110015458 13:70394637-70394659 TTTAAGAAACAGTATTATAAAGG + Intergenic
1110086036 13:71381036-71381058 ATTAAGAAACAGAATTAGCCAGG + Intergenic
1110715456 13:78698128-78698150 ATGAGGAAACCAAATTATGGTGG - Intergenic
1111188949 13:84783027-84783049 ATGAAAAAAGAGAATTAAAAAGG - Intergenic
1111394194 13:87643656-87643678 ATGAAAACACAAAATCATGAAGG - Intergenic
1111432954 13:88167455-88167477 ATGGATAAACTAAATTATGATGG + Intergenic
1111435913 13:88207929-88207951 AGGAAGAAAGAGATTTCTGATGG + Intergenic
1111470025 13:88668463-88668485 ATGAAAACACTGACTTATGAGGG + Intergenic
1111534695 13:89587667-89587689 ATGAAGGAAAAGAATTATCAGGG - Intergenic
1112216830 13:97439505-97439527 ATGAACAAATAGGATTATGGAGG + Intronic
1112892675 13:104258096-104258118 ATAAAGAAAAAGAAGTGTGATGG + Intergenic
1112902250 13:104372135-104372157 GCCAAGAAACAGCATTATGATGG - Intergenic
1113109198 13:106803562-106803584 ATGAAGGAACAGAAGTTTGTTGG - Intergenic
1114367787 14:22048449-22048471 ATGAAGACACAGGGATATGATGG - Intergenic
1114682691 14:24499533-24499555 ATGAAGAAACACAAAAATGCAGG - Intergenic
1115213004 14:30987012-30987034 ATTAAGAAACAAAATTTTGTTGG - Intronic
1115522560 14:34247365-34247387 CTCAGAAAACAGAATTATGAAGG - Intronic
1115810506 14:37101929-37101951 ATGAGGAAACTGAAACATGAGGG - Intronic
1116048624 14:39776467-39776489 ATGTAGAAACATTATTATTAAGG + Intergenic
1117183826 14:53219074-53219096 ATGAAGCAACAGATTTTTGGTGG - Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117748493 14:58896498-58896520 ATCAAGAAAAAGAATTTTAAAGG - Intergenic
1117871936 14:60210406-60210428 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1118505417 14:66405549-66405571 AAGAAGGAAAAGAATAATGAAGG + Intergenic
1118585708 14:67350746-67350768 TTAAAGGAACATAATTATGATGG - Intronic
1118629120 14:67686871-67686893 TTGAAGAAACAGAATTTTTCTGG + Intronic
1119502122 14:75138007-75138029 ATATATAAACAGAATTATTAAGG - Intronic
1119890196 14:78176814-78176836 CTGAAGAAAGAGAACTAAGAAGG - Intergenic
1120223240 14:81759416-81759438 ATAAAGAAACAAAATTATAAAGG - Intergenic
1120406944 14:84102344-84102366 CTCAGGAAACAGAATTATGGTGG - Intergenic
1120601053 14:86510412-86510434 ATAAGAAAACAGAAGTATGAAGG - Intergenic
1120983441 14:90311601-90311623 ATAAAGAAAAAGAATTTTAATGG - Intronic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1123165533 14:106322253-106322275 ATTAACAGACAGAATTATGAAGG - Intergenic
1123898277 15:24850282-24850304 ATAACGATACAGAATTATCAAGG + Intronic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124816657 15:33000734-33000756 TTGAAGAAAAAGGATTATGTTGG + Intronic
1125233963 15:37490278-37490300 ATGAGGAGATAGAATTAGGAAGG + Intergenic
1126644868 15:50865437-50865459 ATGAAGAAACAGCCTCATAAAGG + Intergenic
1127127623 15:55827669-55827691 ATGAAGAAAATGAATTATGATGG + Exonic
1127366106 15:58292178-58292200 ATGAAGACACAGGAATAAGATGG - Intronic
1127473643 15:59312438-59312460 ATGAAGAAACAGAAGCATAAAGG + Intronic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1128930691 15:71702607-71702629 ATGAAGAGACATAATCATGTTGG - Intronic
1129083156 15:73059709-73059731 ATACAGAACCAAAATTATGAGGG - Intronic
1129551102 15:76450298-76450320 ATCAAGACACTGAATTAAGAAGG + Intronic
1130660027 15:85824059-85824081 ATGAAGAAACAGGCTGATGGAGG + Intergenic
1130792212 15:87167577-87167599 ATGAATAACCACAAATATGACGG + Intergenic
1131166082 15:90143231-90143253 ACCAAGAAACAGAATTGTGGAGG - Intergenic
1131591857 15:93758402-93758424 AAGAAGAAACATAATTTTGGGGG + Intergenic
1131603250 15:93871802-93871824 AAGAAGAAACAGAGGTGTGAAGG - Intergenic
1131665154 15:94563245-94563267 TTTAAGAAAGAAAATTATGAAGG + Intergenic
1132010875 15:98275752-98275774 ATGAAGACACGGCCTTATGATGG - Intergenic
1132169319 15:99631773-99631795 ATGAAGAAATAAAATAATGAGGG + Intronic
1132267735 15:100490472-100490494 ATGAAGAAATATAATTGTTAGGG - Intronic
1133387892 16:5385495-5385517 ATAAAGAAACAGAATAATTCGGG + Intergenic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133640138 16:7708772-7708794 GTGTAGAAACAGTATTATGGGGG + Intronic
1135129985 16:19845507-19845529 TTGAAGACACAGAATTTCGAAGG + Intronic
1135358954 16:21794789-21794811 ATGATGAAACACAAATATGTGGG - Intergenic
1136470684 16:30477998-30478020 AAGAAGAAAAAGAAAGATGAAGG + Intronic
1136727055 16:32367260-32367282 ATGAAGACACAAAATTCTGAAGG - Intergenic
1136929424 16:34405990-34406012 ATAAAGCAACATCATTATGAAGG + Intergenic
1136975150 16:35005814-35005836 ATAAAGCAACATCATTATGAAGG - Intergenic
1138045016 16:53712833-53712855 ATCCAGAATCATAATTATGAAGG - Intronic
1138251674 16:55506493-55506515 ATGAAGAAACAGACTTAAAGAGG - Exonic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138723764 16:59113140-59113162 ATGGAGAGAAAGAAATATGATGG - Intergenic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1138956470 16:61976672-61976694 AGAAAGAAACAGTATTAAGAAGG + Intronic
1138957572 16:61990111-61990133 ATAAAGAAACAAAAATATGATGG + Intronic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139799922 16:69514140-69514162 AGGAAGGAACAGAAATATGGTGG + Intergenic
1140070663 16:71646978-71647000 ATGAAGACACATAATTATTATGG + Exonic
1140788395 16:78365799-78365821 ATGAAGACACAGAAATTTGGTGG - Intronic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141525909 16:84611652-84611674 ATGAATAAACAGGAGAATGAAGG + Intronic
1141750770 16:85956428-85956450 ATGAATAAACAGAAGTATTCTGG - Intergenic
1202999379 16_KI270728v1_random:150488-150510 ATGAAGACACAAAATTCTGAAGG + Intergenic
1203130977 16_KI270728v1_random:1686898-1686920 ATGAAGACACAAAATTCTGAAGG + Intergenic
1142489156 17:266711-266733 AGTGAGAAACAGAATTCTGAGGG + Intronic
1142687842 17:1587959-1587981 ATTGAGAAACAGAATTAAGGGGG - Intronic
1142875707 17:2851135-2851157 ACTAAGACAAAGAATTATGAAGG + Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1144265267 17:13562552-13562574 CTGAAGAAACAGTATCCTGATGG + Intronic
1145059518 17:19723965-19723987 ATCAAGAAACAGAACTTTGGTGG + Intergenic
1145081439 17:19897714-19897736 ATGAAGAAATAGAGAGATGAAGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148948617 17:51288512-51288534 ATGAGGAAAGAAAATTGTGAAGG - Intronic
1149084334 17:52696411-52696433 ATAGAGAAATAGAATTTTGAAGG + Intergenic
1149401564 17:56301644-56301666 ATGAAGACACAGAGCTTTGAAGG + Intronic
1149553113 17:57554734-57554756 ATGAAGAAACAGAAGGGTTAAGG + Intronic
1150670137 17:67187848-67187870 ATGCACAAACTGATTTATGAAGG + Intronic
1152836871 17:82538922-82538944 AAGAAGAATCAAAATTCTGAAGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153247711 18:3089737-3089759 ATGAAGAAATAGGCTTAGGAAGG + Intronic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153809873 18:8742583-8742605 TGGAAGTAACAGAATCATGAGGG - Intronic
1153845960 18:9050104-9050126 ATAAAGAAAAAGAATTTTAATGG - Intergenic
1154102250 18:11486938-11486960 ATAAAGAAACAAACTTATGACGG + Intergenic
1154246132 18:12701510-12701532 GTGACGAAACAGATTTATAAAGG - Intronic
1154398818 18:14015504-14015526 AGAAATAAACAGAATAATGATGG - Intergenic
1154468286 18:14670963-14670985 ATGAAGACACAGGAATATGGAGG - Intergenic
1155098605 18:22585538-22585560 CTGAAGAAACAGAAGTCTAAGGG + Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1157771908 18:50356397-50356419 GTGAAGAAAGAGAAACATGAGGG - Intergenic
1158070438 18:53463654-53463676 ATGAAGTAACCAAATTAAGAAGG + Intronic
1158188488 18:54798387-54798409 ATGACAAAACAGAAGCATGAAGG + Intronic
1158276291 18:55771372-55771394 AGGAAAAGAAAGAATTATGAAGG + Intergenic
1158552323 18:58446507-58446529 CTGAGGAAACAGAATAATCATGG - Intergenic
1159816881 18:73085349-73085371 ATGAGGAAACAGACTTAAAAAGG + Intergenic
1160532839 18:79575575-79575597 TTGAAGAAAGAAAAATATGAGGG + Intergenic
1160624919 18:80197151-80197173 ATGCAGAAATTGAATTCTGACGG + Intronic
1162666006 19:12212560-12212582 AGGAAGAAATAAAATTATGTTGG - Intergenic
1162710174 19:12587292-12587314 AAAAAGAAACAAAATTATCAAGG - Intronic
1162858216 19:13485973-13485995 ATGAATAAACAAGATCATGAAGG + Intronic
1164486571 19:28661102-28661124 ATGAAGAAAAAGAGTTTTAATGG - Intergenic
1165647055 19:37449572-37449594 ATGAAGAAACATAATGCTCAAGG - Intronic
1165670670 19:37676101-37676123 GTGAAGAACAAGAAATATGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
1168488925 19:56791019-56791041 AAGAAAAAACAGATTAATGAAGG - Intronic
925299624 2:2801352-2801374 ATGAAGAAAAAGAGGTTTGATGG - Intergenic
925471399 2:4165113-4165135 ATGCAGAGACAGACATATGAAGG + Intergenic
925683276 2:6445402-6445424 AGTCAGAAACAGAACTATGAAGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
927121894 2:19972470-19972492 ATAAAGAACAAGAATTAAGAAGG + Intronic
927310123 2:21620972-21620994 AGGAAGAAGCAGAATTAAGCAGG - Intergenic
927580287 2:24237728-24237750 ATGATGAAACGGAGTTCTGAGGG - Intronic
927879254 2:26679285-26679307 ATGATGAAACACCATTATAATGG - Intergenic
928114198 2:28535282-28535304 AAGAAGAAATAGAATAAAGAGGG - Intronic
928564036 2:32524478-32524500 ATGAAGAAACAGCCTTAGAAAGG - Intronic
928711518 2:34011752-34011774 ATAAAGAGATAGAAGTATGATGG + Intergenic
930315347 2:49790654-49790676 ATAAATAAATAGAATTAAGATGG - Intergenic
930530534 2:52582878-52582900 ATGAGGAATAAGAATTATGAAGG - Intergenic
930662860 2:54072546-54072568 AAGAAGAAAGAAAATAATGAAGG - Intronic
930733863 2:54755190-54755212 ATCCAGAAACAGACTTATTAGGG - Intronic
930757353 2:54990111-54990133 ATGAAGAAACTGAAATATAGAGG - Intronic
930977363 2:57479584-57479606 ATTAATTAACAGATTTATGAAGG - Intergenic
931341355 2:61404210-61404232 ATGAAGAAAGAGAGGTATAAAGG + Intronic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
931829314 2:66034585-66034607 ATGATGAAAAAGAATTATAGAGG - Intergenic
932030211 2:68176062-68176084 TAGAAGAAACAGACTTATGATGG - Exonic
932388572 2:71362535-71362557 ATGATGAAAAGGAATTATAAAGG - Intronic
932861136 2:75292276-75292298 ATGTAGAAACACAAAAATGATGG + Intergenic
933461244 2:82588647-82588669 ATGCAGAAAGAGAATTTTGGGGG - Intergenic
933485118 2:82911611-82911633 ATGATGAAAAAGAATGATTATGG - Intergenic
934098855 2:88632603-88632625 TGGAAGAAACACAATTAAGATGG + Intergenic
934318925 2:91953820-91953842 ATGACGACACAAAATTCTGAAGG + Intergenic
935134391 2:100286874-100286896 AGGAAGTAACAGAATTATAAAGG + Intronic
935313138 2:101805213-101805235 ATCAAGAAACAGAACTTTGCCGG + Intronic
935662199 2:105476699-105476721 TTGAAAAAACAGAATGATAATGG + Intergenic
935712053 2:105908228-105908250 ATGGAGAAACAAAGTTGTGATGG + Intergenic
936944348 2:117917175-117917197 ATGAGGCAGCAGAAATATGAGGG + Exonic
937678726 2:124621038-124621060 TTGATAAAACAGAATTATAAGGG + Intronic
937708615 2:124951027-124951049 ATGAAGAAAAAGAACTTAGAAGG + Intergenic
938211098 2:129466273-129466295 AAGAAGAAACACAATTGTGACGG - Intergenic
938556630 2:132430518-132430540 ATAAAGAACCAGATTTATCAGGG + Intronic
938665104 2:133526586-133526608 ATGAAGAAACAGAATTGCATGGG + Intronic
939150658 2:138468716-138468738 ATGAAGAGCCAGATTTATGTAGG - Intergenic
939197051 2:138986146-138986168 AAAAACAAACAGAATTTTGAAGG - Intergenic
939269287 2:139916989-139917011 ATCAAGAAACAGCATTAGGTGGG - Intergenic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939466005 2:142558031-142558053 ATCAAGAATGAGAATTATTATGG + Intergenic
939614900 2:144351251-144351273 ATGAATAAACTGTATTTTGATGG - Intergenic
939888727 2:147710102-147710124 ATGAACAAACAGATTTATTAGGG - Intergenic
940028599 2:149236112-149236134 AGGAAGAAAAAGCAATATGAAGG + Intergenic
941351595 2:164444181-164444203 ATGATGAAAAAGAATACTGAGGG - Intergenic
941677132 2:168355855-168355877 AAGAAGAAAAAGAATTTGGAAGG - Intergenic
941758990 2:169220002-169220024 ATGAAGGCACAGAAGTATGGCGG - Intronic
944126282 2:196296664-196296686 ATGAAGAAGGAGAATTATAGGGG + Intronic
944257752 2:197641097-197641119 AGAAAGAAAAAGAATTATGATGG + Intronic
944438333 2:199715554-199715576 ATAAAGAAAAAGAAGTTTGATGG - Intergenic
944503682 2:200388029-200388051 TTGAAGAAACAGAAGGATTATGG + Intronic
944531388 2:200670923-200670945 TTGAAGAGACAGAGTAATGACGG - Exonic
944976633 2:205060848-205060870 ATTAAGAAATTCAATTATGATGG + Intronic
944997703 2:205312706-205312728 ATGAAGAAACAAAATATTCATGG - Intronic
945157870 2:206858551-206858573 ATGAAGAAAAATAATTTTAATGG - Intergenic
945483943 2:210371962-210371984 AAGAATAAAAAGAATTATAATGG - Intergenic
945502063 2:210588633-210588655 TTTAAGAAACATTATTATGATGG - Intronic
945670054 2:212791772-212791794 AAGAAGAAACAGGTTTCTGAGGG + Intergenic
945703606 2:213201582-213201604 AGGAAGAATCAGTGTTATGATGG - Intergenic
946758247 2:222967855-222967877 ACTCAGAAACAGAATAATGAAGG - Intergenic
947292382 2:228590614-228590636 AAGAAGAGAGAGAATTAGGAAGG + Intergenic
1169314632 20:4579687-4579709 ATTGAGAAACAAAATCATGAAGG - Intergenic
1169511641 20:6270155-6270177 ATGAAGAAACTGAAGCATAAGGG - Intergenic
1169525517 20:6421042-6421064 ATGAAGAAACAGAACTTTGGAGG - Intergenic
1169655059 20:7913757-7913779 TTGAAGAAAGAAAATAATGAAGG - Intronic
1170047294 20:12098857-12098879 ATGAAGAAAGATCAGTATGAAGG + Intergenic
1170205208 20:13790670-13790692 ATAAAAAAACAGAATCCTGAGGG - Intronic
1173684872 20:44916250-44916272 AAGAAAAAACAGATTTAAGAGGG - Intronic
1174089593 20:48036538-48036560 ATAATAAAACAGAATTATTAAGG - Intergenic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174772125 20:53310199-53310221 ATGAAGAAACAGAAGTTGTATGG + Intronic
1174781984 20:53398136-53398158 ATGAAGAAAAAAAATTACAAAGG + Intronic
1175020131 20:55837378-55837400 ATGAAGAAACAAAATTGGAATGG - Intergenic
1175857562 20:62130670-62130692 AAGAAGAAACTGAATTTTAAAGG + Exonic
1176690785 21:9905655-9905677 TAGAAGAAACAGAATATTGAAGG + Intergenic
1176806231 21:13486686-13486708 ATGAAGACACAGGAATATGGAGG + Intergenic
1177183082 21:17764585-17764607 ATGGATAAAAAGAATTTTGATGG + Intergenic
1177540417 21:22485626-22485648 AAGAAGAAACACATTTATAATGG + Intergenic
1177606260 21:23381422-23381444 AGGAAGAAATAGAATAATGGAGG - Intergenic
1177687862 21:24463387-24463409 AAAGAGAAACAGAAATATGATGG - Intergenic
1177912942 21:27054287-27054309 ATTTAGAAATAGATTTATGAGGG + Intergenic
1178116726 21:29425516-29425538 AAGAAGAAACAGAAGTGTGGGGG + Intronic
1180307104 22:11137481-11137503 ATGAAGACACAAAATTCTGAAGG + Intergenic
1180545624 22:16499664-16499686 ATGAAGACACAAAATTCTGAAGG + Intergenic
1180978735 22:19868672-19868694 ATCAAGAAACAGCATTCTGTGGG + Intergenic
1181998314 22:26900882-26900904 ATGAAGGAACAAGATGATGATGG + Intergenic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1182722278 22:32412986-32413008 ATGACGAAACAGAGATAAGAGGG - Intergenic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183123201 22:35748098-35748120 ATGAAGAAACTGCATTGTGAGGG + Intronic
1183638827 22:39081206-39081228 ATGAAGATCATGAATTATGACGG + Exonic
1183669066 22:39261592-39261614 ATGAGGAAACAGAGATATCAAGG + Intergenic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184377774 22:44125356-44125378 GTGAAGAAAGAGAAGTATTATGG + Intronic
949288271 3:2432087-2432109 ATGAAGAAACAAAAATATTCTGG - Intronic
949640257 3:6028723-6028745 ATGAAGAAAAAAAAATGTGAAGG - Intergenic
950237601 3:11337086-11337108 AAGAAAAAACAGAGTTAAGATGG - Intronic
950593273 3:13954843-13954865 ATGAAGGAAGAGAATCATAAGGG - Intronic
951525173 3:23646558-23646580 ATGCACAAATATAATTATGAAGG + Intergenic
951807296 3:26660095-26660117 ATGGAGTAATATAATTATGAAGG - Intronic
952543503 3:34394481-34394503 ATGAAGTAAAAAAATTATCAGGG - Intergenic
952667561 3:35925077-35925099 ATAAAGAATGAGAATTAAGAAGG - Intergenic
952706952 3:36388327-36388349 ATGAAAAAACAGTATTAAAATGG - Intronic
952844278 3:37674005-37674027 GTAAACAAACAGTATTATGAAGG - Intronic
953212723 3:40890708-40890730 ATCAAGAGACAGAATTAGGCCGG + Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
954225675 3:49179369-49179391 ATGTACTAACAGAATTATGCTGG - Intronic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955192573 3:56775049-56775071 ATGAAGATACCAAATTTTGATGG + Intronic
955501191 3:59584674-59584696 ATCAAGGAACTGAATTTTGATGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956740719 3:72273669-72273691 TTTAAGAAACACAATTAGGAAGG + Intergenic
956819110 3:72936791-72936813 ATCAATACACAGTATTATGATGG - Intronic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957430730 3:80102407-80102429 ATGAAGAAACACAATTATCTTGG - Intergenic
957489295 3:80903449-80903471 AAGAAGCAACTGAATTATGTGGG - Intergenic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
957809687 3:85204129-85204151 ATGAAAAAACTAAATTCTGAGGG - Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
957924403 3:86790080-86790102 ATGAAGAAAGAGATTTATTGTGG - Intergenic
958097849 3:88970848-88970870 ATGAAGTAACAGACTTATTTTGG + Intergenic
958461124 3:94397254-94397276 ATGAAGACCCAGAAGGATGAGGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
959393962 3:105812672-105812694 ATGAAGATACAAAAGTAAGAAGG + Intronic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
959954952 3:112226295-112226317 ATCAAGAAAAAAAATTAAGAAGG + Intronic
960038184 3:113122865-113122887 ATGAAGAAGCTGGATTATAATGG + Intergenic
960043443 3:113173404-113173426 ATGCAGCAACAGAAATATGGAGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960111248 3:113847638-113847660 TTGAAGAAAAACAAATATGATGG + Intronic
960568591 3:119162518-119162540 ATGAAGAAAAAGAAATTTAATGG - Intronic
960581005 3:119278886-119278908 ATGAATAAACTGGATAATGATGG + Intergenic
960665673 3:120106609-120106631 ATATAGAGTCAGAATTATGAAGG + Intergenic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
961902395 3:130225657-130225679 ATAAAGAAACAGAGATAAGAAGG + Intergenic
961933537 3:130558987-130559009 ATGAGGAAACAGACTTTTAAGGG - Intergenic
962188244 3:133282665-133282687 AAGGAGAAATAAAATTATGATGG - Intronic
962491112 3:135894958-135894980 ATGAAGTAACAGAATAATTTTGG + Intergenic
962932875 3:140053755-140053777 ATAATGAAACAGGCTTATGAAGG - Intronic
963053757 3:141165636-141165658 AAGATGAAACAGAATTGTCAAGG + Intergenic
963541128 3:146590031-146590053 AAAAAGAAAAAGAATTATGATGG - Intronic
964039736 3:152245884-152245906 ATGAAGAAGCACAATTGTAACGG - Intronic
964575375 3:158160901-158160923 ATGAAGAAACAGACTTACAGAGG + Intronic
964861697 3:161209533-161209555 ATGAAGAAACCTAATTAGTATGG - Intronic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
964981791 3:162691719-162691741 AAAAAGAATCAAAATTATGAAGG + Intergenic
965043947 3:163551167-163551189 ATGTAGAAAGAGAAAAATGAAGG - Intergenic
965728916 3:171749191-171749213 ATGAAGAAACTAAAGTCTGATGG + Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966299807 3:178465393-178465415 ATGAGGAAACATAATTAGAAAGG - Intronic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966462866 3:180197035-180197057 AGAAAGAAACAAAATTAAGATGG - Intergenic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967076438 3:186007234-186007256 ATTATGAAAAATAATTATGAGGG - Intergenic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967676869 3:192309793-192309815 ATGAAGCCAGAGAATTATGCTGG + Intronic
967927418 3:194662380-194662402 ATGAAGATACTGAACTGTGAAGG + Intronic
968044549 3:195616723-195616745 GAGAAGAAACTGTATTATGAAGG + Intergenic
968060337 3:195722774-195722796 GAGAAGAAACTGTATTATGAAGG + Intronic
968152764 3:196351694-196351716 AAGAAGAAAGAGAAGTGTGAAGG + Exonic
968794738 4:2695286-2695308 ATGAAGAAAAAAAATCATTATGG - Intronic
970076742 4:12230795-12230817 AGGATGAAACAGAGTTATTAAGG - Intergenic
970211770 4:13717341-13717363 TTCAAGATACAGAATTCTGAAGG - Intergenic
970294688 4:14615985-14616007 ATGAAGAAATAGAATCGTGATGG - Intergenic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
971831242 4:31698631-31698653 AAGAAGTATCAGAATTATGAAGG - Intergenic
972594303 4:40516558-40516580 AAGGAGAAATAGAATGATGAGGG - Intronic
972681475 4:41310726-41310748 GTAAAGAAACTGAATCATGAGGG - Intergenic
972931524 4:44077401-44077423 ATTAAGAGACATGATTATGAGGG - Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974583164 4:63833390-63833412 CTCAAGAAAGAGAATGATGAGGG - Intergenic
974593898 4:63992512-63992534 AAATAGAAACAGAAATATGAAGG - Intergenic
974725328 4:65791717-65791739 ATGTAGATAGAGAATTGTGATGG + Intergenic
975545901 4:75560314-75560336 ATGAAGAATGAAAATTTTGAGGG + Intronic
975765387 4:77662227-77662249 ATGAAGAAACAGGATTCGCAAGG - Intergenic
975879190 4:78882816-78882838 ATGAAGCCACAGAATGATAATGG + Intronic
975969998 4:80022029-80022051 ATGAAGAAACAAGCTTATAAAGG + Intronic
976380881 4:84396936-84396958 ATGAAGAAGAAAAAATATGATGG + Intergenic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977951273 4:102973219-102973241 ATGAAGACACAAAATTCTGAAGG + Intronic
978204462 4:106063803-106063825 ATGAAGACACAGCATAAAGATGG + Intronic
978489347 4:109295135-109295157 ATGAAAAAATAGAATTATTAAGG + Intronic
978568808 4:110113810-110113832 ATGTAGAAATAGAATTCAGAAGG + Intronic
978915231 4:114117928-114117950 AAGAAAAAACAGAATTAAGATGG - Intergenic
979441958 4:120760637-120760659 AGGAACAAACAGAAGCATGATGG + Intronic
979804894 4:124959351-124959373 ATGAAGAACCACATATATGATGG - Intergenic
979894228 4:126137879-126137901 ATGAAGAAAGAAAAATATGCAGG + Intergenic
980853315 4:138410307-138410329 TTGAATAATCAGAATAATGATGG + Intergenic
981806692 4:148724363-148724385 ATGAAGAATCAAAAACATGATGG - Intergenic
982160872 4:152568205-152568227 AGAAAGAATCAGACTTATGAAGG - Intergenic
982411559 4:155083669-155083691 ATGAAGTCAAAGAATTATGTTGG - Intergenic
983206181 4:164912381-164912403 ATGAAGAAAATGAAATATGAAGG + Intergenic
983331996 4:166341934-166341956 ATTAAGAAAAAAAATTGTGAAGG + Intergenic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984109115 4:175588065-175588087 TTGAAGAAAGAAAATTATCATGG - Intergenic
984533027 4:180940842-180940864 ATGATGAAACAAAATTATGGAGG + Intergenic
984708249 4:182863486-182863508 GCAAAGAAACAGAAATATGAAGG - Intergenic
984751124 4:183276376-183276398 AGGAAGAAAAAGAATAAAGATGG - Intronic
986128944 5:4909605-4909627 AGGAGGTAACTGAATTATGAGGG - Intergenic
986603665 5:9499880-9499902 AAGAAGAAACCGAAATAAGAAGG + Intronic
986644784 5:9906267-9906289 ATAAAGAAACAGAATTATGTTGG - Intergenic
986852104 5:11825635-11825657 TAAAAGCAACAGAATTATGATGG - Intronic
987112212 5:14698954-14698976 ATGAAGAAACAGATTTAGGGAGG - Exonic
987669559 5:20989726-20989748 ATAATTCAACAGAATTATGAAGG + Intergenic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
988119542 5:26942973-26942995 ATGAAGAAATACAATTTTAAAGG + Intronic
988425451 5:31058380-31058402 AAGAAGAAGCAGAGTTATAATGG + Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
989105122 5:37855927-37855949 ATTAAGAATCACAATTATTAGGG - Intergenic
989346223 5:40432863-40432885 ATTAGGAAACAGAATTAAGGAGG - Intergenic
989529230 5:42487528-42487550 ATGAAAAAAGATAATTATAATGG + Intronic
990821383 5:59844597-59844619 AGGAAGAACCAGATATATGAAGG - Intronic
990895010 5:60689720-60689742 ATGTAGAAGCAGAAATATAACGG + Intronic
990902985 5:60773187-60773209 ATGAAGCTAGAGTATTATGAAGG + Intronic
991779071 5:70114801-70114823 ATCAAGGAAAAGAACTATGAAGG + Intergenic
991858363 5:70990274-70990296 ATCAAGGAAAAGAACTATGAAGG + Intronic
991871520 5:71115156-71115178 ATCAAGGAAAAGAACTATGAAGG + Intergenic
992979287 5:82151029-82151051 ATTATTAAACAAAATTATGAAGG - Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993809051 5:92452812-92452834 ATGAAATAACAGAACTGTGAAGG - Intergenic
993819153 5:92592285-92592307 ATTAAGAAAAAGAGGTATGAAGG + Intergenic
993860714 5:93133535-93133557 TTGAAGAACCAGATTTAGGAAGG - Intergenic
994385950 5:99132009-99132031 ATGAAGAAACATGATGATGTAGG - Intergenic
994410308 5:99399852-99399874 ATGAAGAAACAGAAATAGCTTGG - Intergenic
994483512 5:100365424-100365446 ATGAAGAAACAGAAATAGCTTGG + Intergenic
995018206 5:107337075-107337097 ATGAAGAAATAAAAGTGTGAAGG - Intergenic
995524261 5:113038198-113038220 AGGAAGAAACAGAATTGTATTGG + Intronic
995553191 5:113300542-113300564 CTGAAGAAAGTGAATTTTGAGGG + Intronic
995823212 5:116262444-116262466 ATTAAGAAACTGAAGAATGATGG - Intronic
996075835 5:119192747-119192769 ATGAAGAAAGAAGATTATGAAGG - Intronic
996209341 5:120786187-120786209 ATTAAGAAACAGAAATATTTGGG - Intergenic
996251733 5:121343092-121343114 AGGAAGAAAGAAAATTATGGGGG + Intergenic
996587553 5:125107468-125107490 AGAAAGTAACAGAATTATCAGGG + Intergenic
996809450 5:127499449-127499471 ATAAATAAAAAGGATTATGAAGG + Intergenic
997281209 5:132647277-132647299 ATGAAGAAGCAGATTTTGGATGG - Intergenic
997402963 5:133616738-133616760 ATGAATATGCAGTATTATGATGG + Intergenic
997438187 5:133890189-133890211 ATGGAGAAACAGTATTGTAAGGG + Intergenic
997741542 5:136259211-136259233 ATGAAGAAACTCACCTATGAAGG + Intronic
998592516 5:143492419-143492441 ATAAATAAACACAATTCTGAAGG - Intergenic
998753089 5:145346117-145346139 ATGAATAAACAGAATTTCAAAGG - Intergenic
999569472 5:152902516-152902538 ATGAACAAACAGGATTATTCAGG + Intergenic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1000527402 5:162374914-162374936 ATGATGAAAGGGAATTATGTAGG - Intergenic
1000570589 5:162908665-162908687 CTGAATAAAGAGAATTCTGATGG + Intergenic
1000624332 5:163521987-163522009 ATGAATAAATAGAATAATGAGGG - Intergenic
1001871329 5:175158488-175158510 GTGTAAAAACAGAATTATAATGG + Intergenic
1002040347 5:176508970-176508992 AAGAAGAGACTGAATTATGATGG - Exonic
1002795525 6:468198-468220 CTGAATAAACAGAAATGTGATGG + Intergenic
1002826397 6:777944-777966 ATGAAGACACAGGAAGATGAAGG + Intergenic
1003347134 6:5280587-5280609 ATAAAGAAACTGAAGTATCAAGG - Intronic
1005709072 6:28486085-28486107 AAGAAGAAAAAGAATTGAGAGGG + Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007602797 6:43093770-43093792 ATGAAGCAACAGAAGAACGAAGG + Intronic
1007744745 6:44036648-44036670 ATGAAGAAACAGACTCTAGATGG + Intergenic
1007946159 6:45828909-45828931 AGGAACAAACAGAAAAATGAAGG + Intergenic
1008052475 6:46914290-46914312 CTGAAAATACAGATTTATGAAGG - Intronic
1008307516 6:49921837-49921859 ATGAGAAAAGAGAATCATGAGGG + Intergenic
1008601868 6:53104268-53104290 ATGTAAAAACAGAATTAAAATGG - Intergenic
1008756396 6:54799510-54799532 ATATAGAAACAAAATTATGATGG - Intergenic
1009567420 6:65326985-65327007 AGGAAGAAACACAATTATTGTGG - Intronic
1009661316 6:66614697-66614719 ATGAAAAATTATAATTATGAAGG + Intergenic
1010348923 6:74848291-74848313 ATGCAGAAACAGAAATATTGTGG + Intergenic
1011049641 6:83130635-83130657 ATAAAGAAAGAGAAGTATTAGGG + Intronic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011518238 6:88175906-88175928 ATGAAGAACCAGTATTGTGCTGG + Intergenic
1011538532 6:88404644-88404666 ATGAAGAAAAATGATTATGCTGG + Intergenic
1011813036 6:91155062-91155084 ATTAAGATACAGTATGATGAGGG + Intergenic
1012200142 6:96395929-96395951 CTTAAAAAAAAGAATTATGAAGG - Intergenic
1012900337 6:104997658-104997680 ATGATGATAGAGAATAATGATGG + Intronic
1012913754 6:105145893-105145915 AAGAAGATAGTGAATTATGAAGG + Intergenic
1013105236 6:107021467-107021489 ATGAAGATCCAGAAGAATGAGGG - Intergenic
1013175453 6:107673059-107673081 AAGAAGAAAGAGAAATAAGAAGG + Intergenic
1013346728 6:109267741-109267763 ATCAAGAGACACCATTATGATGG - Intergenic
1013678517 6:112494735-112494757 ATGAGGAGACAGAATCTTGAAGG + Intergenic
1013796408 6:113894120-113894142 ACAAGGAAACAGAATAATGAGGG - Intergenic
1014020093 6:116576791-116576813 ATGCAGAAACAGGACTCTGAGGG + Intronic
1014591706 6:123280529-123280551 AGGAAGATTCAAAATTATGAAGG - Intronic
1014955572 6:127611315-127611337 GTGAAGAAAAAGAATTATCATGG - Intergenic
1015036647 6:128663885-128663907 ATTAAGAGACAGAATTCTTAAGG - Intergenic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015669779 6:135675321-135675343 AAGAATAAATAGAAATATGAGGG - Intergenic
1015725381 6:136294160-136294182 ATGGGGCAACAGAATCATGATGG + Intergenic
1017219220 6:151946657-151946679 ATTAAAAAAAAGAATTATAAAGG + Intronic
1017380073 6:153817924-153817946 ATGAAGAAGCAGAATCTTCAGGG + Intergenic
1018091528 6:160349653-160349675 ATGCAGAAACAGATTACTGAGGG - Intronic
1018140791 6:160833136-160833158 AGGAAGAAACACAATTATTGTGG - Intergenic
1018315652 6:162554155-162554177 ATGAAGATACAGGATACTGAGGG + Intronic
1018348550 6:162929457-162929479 ATTAATAACCAGAATTATAAGGG - Intronic
1018662361 6:166099955-166099977 ATGAAGGAACTGAAATCTGATGG - Intergenic
1019022905 6:168933365-168933387 GTAAAGCAACATAATTATGATGG - Intergenic
1019116598 6:169769149-169769171 AAGAAGCAACAGACTTTTGAAGG + Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019939120 7:4275288-4275310 AAGAAGAAAAAGAAAGATGAGGG + Intergenic
1020470694 7:8531099-8531121 AAGAAGGAACAGAATCTTGATGG - Intronic
1020562125 7:9741386-9741408 ATGAGGGAACAGAATTATCTTGG - Intergenic
1021682053 7:23143281-23143303 ATGAAGCAACAGTATTATTTTGG + Intronic
1022734116 7:33060322-33060344 ATCAAGAAACTGAATTGTAAAGG - Intronic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1022865914 7:34419810-34419832 ATAAAGAAAAAGAATTTTAATGG - Intergenic
1023675798 7:42628473-42628495 AAGAAGAAAGATATTTATGATGG - Intergenic
1023708597 7:42968124-42968146 ATGAAGAAAAAGAGGTTTGATGG - Intergenic
1024367685 7:48540293-48540315 ATGATGAAATAGAATTACAAAGG - Intronic
1024494779 7:50032991-50033013 AAGCAGAAAAAGAATTATGTGGG + Intronic
1024635226 7:51282953-51282975 ATGGAGAAAGAGAACTCTGAGGG + Intronic
1024652487 7:51417332-51417354 ATAAAGACACAGAATTACGTTGG - Intergenic
1024763947 7:52633942-52633964 ATGAAGAAGAACAATTAAGAGGG - Intergenic
1024989925 7:55225138-55225160 AGCAAGATGCAGAATTATGATGG - Intronic
1025037667 7:55607977-55607999 ATAAAGACACAGAATTACGTTGG - Intergenic
1025063666 7:55833879-55833901 AGAAATAAACAGAATTATAAGGG + Intronic
1025279336 7:57615509-57615531 ATGAGGAAACATAAATATAAGGG + Intergenic
1025305395 7:57849991-57850013 ATGAGGAAACATAAATATAAGGG - Intergenic
1025618734 7:63148175-63148197 AGAAATAAACAGAATTATAAGGG + Intergenic
1026152826 7:67802674-67802696 ATGCAGAAACAGAGCAATGAGGG - Intergenic
1026181997 7:68049735-68049757 ATGGTGAAACAGAATCATGTTGG + Intergenic
1026956575 7:74380060-74380082 ATGTATGAACAGAAGTATGAGGG + Intronic
1027023855 7:74836491-74836513 ATGAAGAAACTGAAATTTAAAGG + Intronic
1027064074 7:75108830-75108852 ATGAAGAAACTGAAATTTAAAGG - Intronic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1027710459 7:81594625-81594647 ATGAAGAAACAAAATCATATGGG - Intergenic
1027811930 7:82914457-82914479 ATCAAGAAACAGAACAATAAAGG + Intronic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1027854707 7:83495537-83495559 AAGCAGAAACATAATTATTAGGG + Intronic
1027885176 7:83895015-83895037 TTGAAGAAACAGTAGTATAAAGG + Intergenic
1028233895 7:88337345-88337367 AAGGAGAAACTGAACTATGATGG + Intergenic
1028945613 7:96576143-96576165 ATGAAAACACAAAATTATGTAGG - Intronic
1029520648 7:101059621-101059643 GAAAAGAAACAGAATTTTGATGG - Intergenic
1030405067 7:109100397-109100419 ATGACCTAACAGAATTCTGAAGG - Intergenic
1030563577 7:111122221-111122243 ATAAAAAAAAAGAATTATCAAGG + Intronic
1030645134 7:112052686-112052708 ATGAGGAAACAGCATTATTGCGG - Intronic
1030853628 7:114522674-114522696 ATGTAGTTACAGAATTATTAAGG + Intronic
1030951789 7:115799943-115799965 ATGAAACAACAGATTTCTGAGGG + Intergenic
1031097659 7:117440754-117440776 ATAAAGAAAGTGAATGATGATGG - Intergenic
1031828709 7:126599832-126599854 ATGAAGTAACAGGACTATGCGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032288000 7:130557864-130557886 ATGAAAATAAAGAACTATGATGG + Intronic
1032531605 7:132625288-132625310 CTGAAGGAGCAGAATTATGAAGG + Intronic
1035116253 7:156526632-156526654 GAAAAGAAAAAGAATTATGAGGG + Intergenic
1035906662 8:3518238-3518260 TTGAAGAAACATATTTATGAAGG - Intronic
1036828140 8:11995611-11995633 ATGAGGAAACAGATTTAGAACGG - Intronic
1037166201 8:15832011-15832033 ATGAAAAAACAGTATGTTGAAGG + Intergenic
1037395878 8:18442183-18442205 AGGAAGAAAAAGAATTATCTTGG + Intergenic
1037543519 8:19895343-19895365 AGGAAGAAACATCATTAAGAAGG + Intergenic
1038166426 8:25089055-25089077 ATGAGGAAACAGAGTTTTCAAGG - Intergenic
1038347474 8:26745527-26745549 ATGAAGAAAAACAACTCTGACGG - Intergenic
1038625189 8:29185727-29185749 ATGTAAAAACAGCATTAGGAAGG - Intronic
1038902487 8:31859333-31859355 ATGGAAAAACAAGATTATGATGG - Intronic
1038918992 8:32061375-32061397 ATTGAGAAACAGTTTTATGAGGG - Intronic
1038959439 8:32502710-32502732 ATGAAGAAACAAAACTCTGCAGG - Intronic
1039697035 8:39923963-39923985 GTAAAAAAACAGAATTAGGAAGG - Intronic
1040632112 8:49226375-49226397 ATAAATAAAAAGAATTATAAAGG + Intergenic
1041554625 8:59139111-59139133 ATTAAGAAACAGTTTTATTAAGG - Intergenic
1043343014 8:79264647-79264669 ATAAAGAAACAGAAGTCTGAAGG + Intergenic
1043854447 8:85248470-85248492 AAAAAGAAAAAGAATTATGGTGG + Intronic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044911917 8:97068786-97068808 ATGAAGAAACAGACTCATAAGGG + Intronic
1045555173 8:103208624-103208646 ATTAAAAGACAAAATTATGAAGG - Intronic
1046726510 8:117680620-117680642 CTGAAGAAACTGAATTTTTAAGG + Intergenic
1047460914 8:125064515-125064537 ATTAATAAACAGAATTAAGGCGG - Intronic
1047486818 8:125338801-125338823 ATGATGAAACTGAATGATTATGG + Intronic
1047553764 8:125906759-125906781 AAGAAGAAAAAATATTATGAAGG - Intergenic
1047694449 8:127389246-127389268 ATGCAGCTACTGAATTATGAAGG - Intergenic
1047824738 8:128561029-128561051 ATGAAGAAATACAATTCTAATGG - Intergenic
1050136567 9:2472047-2472069 ATGAAGAAAGAGAATAATCAGGG - Intergenic
1050225339 9:3448497-3448519 AAGAAGAAAAAGAAATATGTGGG - Intronic
1050264790 9:3878874-3878896 ATTGGGAAACAGAAGTATGAAGG + Intronic
1052559618 9:30068473-30068495 ATTAAGAAACGGAATTATATTGG + Intergenic
1052609465 9:30753967-30753989 ATCAAAAAAGAGAATGATGAAGG + Intergenic
1052766041 9:32641716-32641738 TTTAAGAAAAAGAATTATAATGG + Intergenic
1053627517 9:39890171-39890193 TAGAAGAAACAGAATATTGAAGG + Intergenic
1053778476 9:41575849-41575871 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054166438 9:61786093-61786115 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054216370 9:62360532-62360554 TAGAAGAAACAGAATATTGAAGG - Intergenic
1054671111 9:67794811-67794833 TAGAAGAAACAGAATATTGAAGG + Intergenic
1055508931 9:76975570-76975592 ATTAAGAAGCTGAATTATCAAGG - Intergenic
1056234687 9:84582916-84582938 ACAAAGAGACAGAATGATGATGG + Intergenic
1056624412 9:88242946-88242968 ATGAAATAACACAATTATCAAGG + Intergenic
1058094956 9:100849343-100849365 ATAAAGTTACAAAATTATGAGGG + Intergenic
1058135753 9:101305960-101305982 ATAAAGAAAGAGGATGATGAAGG - Intronic
1058358592 9:104113454-104113476 ATGAAAAAGCTAAATTATGAAGG + Exonic
1058400940 9:104618388-104618410 ATGCAGGAAGAGAAATATGAGGG + Intergenic
1058581821 9:106466910-106466932 ATGAAGAAACAGATTAAGTAAGG + Intergenic
1058626354 9:106937222-106937244 ATGAAAAAATAGAATAAAGAGGG + Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058665492 9:107310822-107310844 ATGAAGAAACAGGCTTAGAAAGG + Intronic
1058890452 9:109356405-109356427 ATGCAAAAACAGAACTGTGAGGG - Intergenic
1059026260 9:110635560-110635582 ATGAAGAAAAAGATTTATCAGGG - Intergenic
1059658745 9:116380510-116380532 ATAAATGAACAGAATAATGATGG - Intronic
1059715940 9:116913395-116913417 ATGAGAAAACAGAATTAATAAGG - Intronic
1059758505 9:117316640-117316662 AGGCAGAAACACAATTCTGAGGG - Intronic
1060044143 9:120326652-120326674 ATAAAGCAAAAGAATAATGAAGG - Intergenic
1060575150 9:124685111-124685133 ATGAAGAAACAGATTTAGAAGGG - Intronic
1062017664 9:134299307-134299329 ATGTAGAAAGAGGTTTATGATGG - Intergenic
1186241417 X:7571172-7571194 ATGAAGAAAAAGAAGTTTAATGG + Intergenic
1187995741 X:24924655-24924677 GTGAACAGACAGAATTATGGAGG + Intronic
1188432841 X:30125685-30125707 TGGCAGAAACAGAATAATGAGGG + Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1189703830 X:43739635-43739657 CTGAAGAGACAAAATTATGCAGG - Intronic
1189806959 X:44744846-44744868 ATTAAGAGACAGAGTTAAGAAGG + Intergenic
1190019114 X:46856248-46856270 ATGAAGAAACACTGTTTTGATGG - Intronic
1190989484 X:55531318-55531340 ATGAAGAAACTTGATGATGAAGG - Intergenic
1191752532 X:64558749-64558771 CTGAAGAAATAGTGTTATGATGG - Intergenic
1192139396 X:68634666-68634688 AAGATGAAACAGATTCATGAAGG + Intergenic
1192190182 X:68986347-68986369 ATGAAGACATAGAATCATGGAGG - Intergenic
1193947906 X:87762036-87762058 ATGAAGAAAAAGATTTAAAAAGG - Intergenic
1194069744 X:89306635-89306657 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1194167083 X:90530410-90530432 ATGAAGAAAACAAATTATGTGGG + Intergenic
1194330336 X:92576280-92576302 ATAAAGAAACACACCTATGAAGG - Intronic
1194610389 X:96035952-96035974 AGGAAGAAATAGAATGGTGAAGG - Intergenic
1194745951 X:97628394-97628416 ATAAAGAAACAGAGTTTTAATGG - Intergenic
1194896830 X:99452559-99452581 ATGATGAAAGTGAATTATGAAGG - Intergenic
1195402764 X:104479329-104479351 ATGAATAAACAGAATTAGATTGG - Intergenic
1195794101 X:108624539-108624561 AAGAAGAAACTGAATAATCAAGG - Intronic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1197878675 X:131140650-131140672 ATAAAGAAACGGCATTGTGATGG - Intergenic
1198143814 X:133834091-133834113 ATTATGAAACAGCAATATGATGG - Intronic
1198797724 X:140416700-140416722 ATCATGAAACAGAATCATGGGGG - Intergenic
1198966711 X:142235633-142235655 TTGAAGAAACAGAATTACCTGGG - Intergenic
1199782441 X:151074792-151074814 ATGATGAAACACAATTAATAAGG + Intergenic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic
1200513350 Y:4108186-4108208 ATGAAGAAAACAAATTATGTGGG + Intergenic
1200639041 Y:5695353-5695375 ATAAAGAAACACACCTATGAAGG - Intronic
1200723891 Y:6640776-6640798 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1200871624 Y:8105447-8105469 ATGAAGAAAAAGAATTCAGTTGG - Intergenic
1201186478 Y:11408903-11408925 ATGAAGACACAAAATTCTGAAGG + Intergenic
1201798695 Y:17929000-17929022 ATAAAGAAAAAGAAAAATGAAGG - Intergenic
1201802858 Y:17976957-17976979 ATAAAGAAAAAGAAAAATGAAGG + Intergenic
1202328487 Y:23719393-23719415 AAGAAGATACAGAATTAAGGAGG + Intergenic
1202542284 Y:25950660-25950682 AAGAAGATACAGAATTAAGGAGG - Intergenic