ID: 984010853

View in Genome Browser
Species Human (GRCh38)
Location 4:174369795-174369817
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984010851_984010853 13 Left 984010851 4:174369759-174369781 CCTGTCTCAGATATTCAGCTTCA No data
Right 984010853 4:174369795-174369817 TCTTGGCCCCCTCAGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr