ID: 984012579

View in Genome Browser
Species Human (GRCh38)
Location 4:174388345-174388367
Sequence GGTGTCCTCACATGGAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984012579_984012582 -2 Left 984012579 4:174388345-174388367 CCTGGTTTCCATGTGAGGACACC No data
Right 984012582 4:174388366-174388388 CCTAGAAAGCAACATCTACGAGG No data
984012579_984012583 30 Left 984012579 4:174388345-174388367 CCTGGTTTCCATGTGAGGACACC No data
Right 984012583 4:174388398-174388420 TAACCAGACACCAAATCTGCTGG 0: 7
1: 186
2: 558
3: 1038
4: 1564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984012579 Original CRISPR GGTGTCCTCACATGGAAACC AGG (reversed) Intergenic
No off target data available for this crispr